BioMed Research International / 2014 / Article / Tab 1

Research Article

Detection of Carbapenemase-Producing Enterobacteriaceae in the Baltic Countries and St. Petersburg Area

Table 1

(a) Primers for the detection of carbapenemase-encoding genes. (b) Primers and probes used for multiplex real-time PCR detection of classes 1, 2, and 3 integrons.
(a)

Reaction numberPrimersOligonucleotide sequence (5′-3′)Volume for reaction

PCR
Mix 1
IMP (forward)GAATAGRRTGGCTTAAYTCTC 2.5  L
IMP (reverse)CCAAACYACTASGTTATC2.5  L
VIM (forward)GTTTGGTCGCATATCGCAAC0.25  L
VIM (reverse)AATGCGCAGCACCAGGATAG0.25  L
GIM (forward)TCAATTAGCTCTTGGGCTGAC0.25  L
GIM (reverse)CGGAACGACCATTTGAATGG0.25  L

PCR
Mix 2
NDM (forward)CAATATTATGCACCCGGTCG0.5  L
NDM (reverse)ATCATGCTGGCCTTGGGGAA0.5  L
OXA 48 (forward)GCGTGGTTAAGGATGAACAC0.5  L
OXA 48 (reverse)CATCAAGTTCAACCCAACCG0.5  L

PCR
Mix 3
KPC (forward)GGCAGTCGGAGACAAAACC0.5  L
KPC (reverse)CCCTCGAGCGCGAGTCTA0.5  L

(b)

Primers/probesOligonucleotide sequence (5′-3′)Location

intI1-LC1GCCTTGATGTTACCCGAGAGintI1
intI1-LC5GATCGGTCGAATGCGTGT
intI2-LC2TGCTTTTCCCACCCTTACCintI2
intI2-LC3GACGGCTACCCTCTGTTATCTC
intI3-LC1GCCACCACTTGTTTGAGGAintI3
intI3-LC2GGATGTCTGTGCCTGCTTG

intI1-probeATTCCTGGCCGTGGTTCTGGGTTTTintI1
intI2-probeTGGATACTCGCAAACAAGTTATTTTTACGCTGintI2
intI3-probeCGCCACTCATTCGCCACCCAintI3