Disruption of HPV16-E7 by CRISPR/Cas System Induces Apoptosis and Growth Inhibition in HPV16 Positive Human Cervical Cancer Cells

Table 1

Sequences of CRISPR gRNAs used in this paper.

Name	gRNA sequence (5′-3′)	PAM sequence (5′-3′)	DSB breaking site (bp) in HPV16 genome
gRNA-1	aacccagctgtaatcatgca	TGG	564
gRNA-2	acattgcatgaatatatgtt	CCT	583
gRNA-3	gagacaactgatctctactg	CCA	616
gRNA-4	gctggacaagcagaaccgga	CCA	688
HPV16E6-gRNA-1	gtcgatgtatgtcttgttgc	CCG	Not inducing DSB