Research Article
In Vitro Antiviral Activity of Circular Triple Helix Forming Oligonucleotide RNA towards Feline Infectious Peritonitis Virus Replication
Table 1
Sequences of FIPV-specific circular TFOs.
| TFOs | TFO sequences | Target sequence* | Target gene and position |
| TFO1 | GAGAAGAAAAGGAAA C C C C GAGAAGAAAAUGAAA | 50′ tataactcttcttttactttaacta 3′ | 5′UTR and 36–50 | TFO2 | AAAAGGAAAA C C C C AAAAGGAAAA | 5′ gaaaattttccttttgatag 3′ | 3′UTR and 29335–29344 | TFO3 | GGAUAAGAGGAA C C C C GGACAAGAGGAA | 5′ ttaaacctgttctccttaccga 3′ | ORF1a/1b and 530–541 | TFO4 | AAAGAGGGGAGAA C C C C AAAGAGGUGAGAA | 5′ caggatttctccactcttagttc 3′ | ORF1a/1b and 7399–7411 | TFO5 | AAAGGGAAGAAAGA C C C C AAAGUGAAGAAAGA | 5′ aggagtttcacttctttctaccat 3′ | ORF1a/1b and 14048–14061 | TFO7** | UUUUUAUUUUUAU C C C C UUUUUAUUUUUAU | — | — |
|
|
Highlighted in bold indicated the binding region. Unrelated circular TFO.
|