Research Article
Monocolonization of Germ-Free Mice with Bacteroides fragilis Protects against Dextran Sulfate Sodium-Induced Acute Colitis
Table 1
Real-time PCR primers used in this study.
| | Gene (NCBI ID) | Orientation | Sequence (-) | UPL |
| | TNF- | Forward | tgcctatgtctcagcctcttc | 49 | | (NM_013693.2) | Reverse | gaggccatttgggaacttct | | IL-10 | Forward | cagagccacatgctcctaga | 41 | | (NM_010548.1) | Reverse | tgtccagctggtcctttgtt | | IL-17 | Forward | cagggagagcttcatctgtgt | 74 | | (NM_010552.3) | Reverse | gctgagctttgagggatgat | | iNOS | Forward | gggctgtcacggagatca | 76 | | (NM_010927.3) | Reverse | ccatgatggtcacattctgc | | -Actin | Forward | ctaaggccaaccgtgaaaag | 64 | | (NM_007393.3) | Reverse | accagaggcatacagggaca |
|
|
