BioMed Research International

BioMed Research International / 2014 / Article

Erratum | Open Access

Volume 2014 |Article ID 675857 | https://doi.org/10.1155/2014/675857

Sílvia Bofill-Mas, Marta Rusiñol, Xavier Fernandez-Cassi, Anna Carratalà, Ayalkibet Hundesa, Rosina Girones, "Erratum to “Quantification of Human and Animal Viruses to Differentiate the Origin of the Fecal Contamination Present in Environmental Samples”", BioMed Research International, vol. 2014, Article ID 675857, 2 pages, 2014. https://doi.org/10.1155/2014/675857

Erratum to “Quantification of Human and Animal Viruses to Differentiate the Origin of the Fecal Contamination Present in Environmental Samples”

Received13 May 2014
Accepted21 Jul 2014
Published28 Aug 2014

The primer Q-PAdV-R was mismatched with probe Q-PAdV-P in Table 1. The table is corrected here.


Primers and probesVirusPositionaReferenceSequence (5′-3′)

ADFHuman adenovirus (HAdV)18869–1888726CWTACATGCACATCKCSGG
ADR18919–18937CRCGGGCRAAYTGCACCAG
ADP118889–18916FAM-CCGGGCTCAGGTACTCCGAGGCGTCCT-BHQ1

JE3FJC polyomavirus (JCPyV)4317–433927ATGTTTGCCAGTGATGATGAAAA
JE3R4251–4277GGAAAGTCTTTAGGGTCTTCTACCTTT
JE3P4313–4482FAM-AGGATCCCAACACTCTACCCCACCTAAAAAGA-BHQ1

QB-F1-1Bovine polyomavirus (BPyV)2122–214428CTAGATCCTACCCTCAAGGGAAT
QB-R1-12177–2198TTACTTGGATCTGGACACCAAC
QB-P1-22149–2174FAM-GACAAAGATGGTGTGTATCCTGTTGA-BHQ1

Q-PAdV-FPorcine adenovirus (PAdV)20701–2071829AACGGCCGCTACTGCAAG
Q-PAdV-R20751–20768AGCAGCAGGCTCTTGAGG
Q-PAdV-P20722–20737FAM-CACATCCAGGTGCCGC-BHQ1

qOv_FOvine polyomavirus (OPyV)VP  region30CAGCTGYAGACATTGTGG
qOv_RTCCAATCTGGGCATAAGATT
qOv_PFAM-ATGATTACCAAGCCAGACAGTGGG-BHQ1

Q-PaV-FChicken/turkey parvovirus (ChPV/TuPV)3326–334531AGTCCACGAGATTGGCAACA
Q-PaV-R3388–3407GCAGGTTAAAGATTTTCACG
Q-PaV-Pr3356–33786FAM-AATTATTCGAGATGGCGCCCACG-BHQ1

aThe sequence positions are referred to strains J01917.1 (HAdV), NC_001699.1 (JCPyV), D13942 (BPyV), AJ237815 (PAdV), and GU214706 (ChPV/TuPV) from Genbank. bVP1: virion protein 1.

Copyright © 2014 Sílvia Bofill-Mas et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views566
Downloads415
Citations

Related articles