BioMed Research International / 2014 / Article / Tab 3

Research Article

Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

Table 3

Primers designed in this study for the amplification of the L. monocytogenes virulence genes.

PrimerSequence 5′-3′TargetProduct (bp)

inlA ext Fw CGGCTCCGTAGACAGATTAGinlA 2884
inlA ext Rv GTGATAGTCTCCGCTTGTAC
inlA In 1-Fw GTGAGAAGAAAACGA1200
inlA Detec-Rv TGGTGTAAGATCGCT
inlA Detec-Fw AAGTGATATAACTCC

inlB ext Fw GCTAGATGTGGTTTTCGGACTinlB 2146
inlB ext Rv TAAGCAGCGCAAAGGTGATTCCTAC
inlB In-Fw GTGAAAGAAAAGCAC1227
inlB Seq 3-Rv ATTCCCGCGAATATA
inlB Seq 2-Fw TGATGGAACGGTAAT900
inlB End 3-Rv TNATTTCTGTGCCCT

plcB ext Fw CCATACGACGTTAATTCTTGCAATGplcB 1039
plcB ext Rv TATCCACCCGCTAACGAGTG

plcA ext Fw GAGGTTGCTCGGAGATATACplcA 1100
plcA ext Rv CTGCTGTCCCTTTATCGTCG
plcA Detec-Fw AACCATTATTATGCG396
plcA Detec-Rv TGCAGCATACTGACG

hly ext Fw CGATAAAGGGACAGCAGGACThly 1796
hly ext Rv AGCCTGTTTCTACATTCTTCACAA
hly Detec-Fw TAACAACGCAGTAAA566
hly Detec-Rv CGTAAGTCTCCGAGG
hly End-Fw CCTCCTGCATATATC725
hly End-Rv TTATTCGATTGGATT

inlC In 1-Fw ATGCTAGTNTTAATTGTAinlC 852
inlC End 2-Rv CTAATTCTTGATAGGTTGTG

prfA Detec-Fw CTGCTAACAGCTGAGCTATGprfA 404
prfA Detec-Rv GCTACCGCATACGTTATC
prfA End Rv ATGAACGCTCAAGCA

In: primers corresponding to the beginning of the gene; End: primers corresponding to the end of the gene; Detec: internal primers designed for gene detection; ext: external primers; Seq: internal primers designed for sequencing.

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.