Research Article | Open Access
Guo-dong Feng, Xiao-chang Xue, Mei-li Gao, Xian-feng Wang, Zhen Shu, Nan Mu, Yuan Gao, Zeng-lu Wang, Qiang Hao, Wei-na Li, Meng Li, Cun Zhang, Wei Zhang, Ying-qi Zhang, "Therapeutic Effects of PADRE-BAFF Autovaccine on Rat Adjuvant Arthritis", BioMed Research International, vol. 2014, Article ID 854954, 9 pages, 2014. https://doi.org/10.1155/2014/854954
Therapeutic Effects of PADRE-BAFF Autovaccine on Rat Adjuvant Arthritis
Abstract
B cell activating factor (BAFF) is a cytokine of tumor necrosis factor family mainly produced by monocytes and dendritic cells. BAFF can regulate the proliferation, differentiation, and survival of B lymphocytes by binding with BAFF-R on B cell membrane. Accumulating evidences showed that BAFF played crucial roles and was overexpressed in various autoimmune diseases such as systemic lupus erythematous (SLE) and rheumatoid arthritis (RA). This suggests that BAFF may be a therapeutic target for these diseases. In the present study, we developed a BAFF therapeutic vaccine by coupling a T helper cell epitope AKFVAAWTLKAA (PADRE) to the N terminus of BAFF extracellular domains (PADRE-BAFF) and expressed this fusion protein in Escherichia coli. The purified vaccine can induce high titer of neutralizing BAFF antibodies and ameliorate the syndrome of complete Freund’s adjuvant (CFA) induced rheumatoid arthritis in rats. Our data indicated that the BAFF autovaccine may be a useful candidate for the treatment of some autoimmune diseases associated with high level of BAFF.
1. Introduction
B cell activating factor (BAFF) is a member of tumor necrosis factor (TNF) family [1]. It is predominantly expressed by monocytes, macrophages, dendritic cells, and T cells [2, 3] and can form homotrimers or heterotrimers with a proliferation inducing ligand. BAFF is also responsible for regulating B cell maturation, survival, and function by binding to the receptors BAFF-R, TACI, or BCMA on B cells [4]. The active BAFF in vivo can occur in a soluble or membrane-bound form.
It has been shown that BAFF is a key regulator for B cell homeostasis [5]. B cell differentiation is severely perturbed in mice [6–8]; in contrast, BAFF transgenic mice develop autoimmune diseases resembling human SLE and Sjögren’s syndrome [9–11]. Furthermore, overexpression of BAFF was found in sera of SLE and RA patients and BAFF/APRIL heterotrimers were also elevated in patients with various autoimmune conditions [12–15]. In light of the roles of BAFF in B cell function and these clinical data, BAFF may be regarded as a novel therapeutic target for the treatment of some human autoimmune diseases [16–18].
Rheumatoid arthritis (RA) is a chronic systemic inflammatory disorder that mainly affects the synovial joints but can also have systemic manifestations [19]. RA is characterized by hyperplasia of synovial cells, elevated cytokines and autoantibodies in synovial fluid, development of pannus in synovium, and infiltration of inflammatory lymphocytes including activated B cells [20]. Although the detailed mechanism of RA is still largely unknown, the progress in B cell-targeted therapies has greatly expanded our understanding of the critical role of B cells in RA pathogenesis [21, 22]. The contributions of B cells to antibody production, antigen presentation, T cell activation, and proinflammatory cytokines (such as TNF-) secretion make BAFF a rational target for therapeutic reagents development in RA [17, 18].
In recent years, a novel vaccine construction strategy targeting self-proteins has been developed for treating various autoimmune diseases [23]. Immunological tolerance can be overcome by incorporating a T helper cell epitope within self-protein, which is helpful for eliciting therapeutic antibodies [24, 25]. PADRE T helper epitope (AKFVAAWTLKA) can bind to 15 of 16 of the most common HLA-DR types found to date with high or intermediate affinity. In this study, we constructed and expressed the therapeutic BAFF autovaccine by coupling the PADRE T helper epitope to the N terminus of BAFF (named PADRE-BAFF). Then, the therapeutic effect of the vaccine was investigated in the rat adjuvant arthritis (AA, an experiment animal model of RA). Our data demonstrated that high titer of antibodies was induced by the autovaccine in animals and that the induced antibodies could neutralize BAFF bioactivity both in vitro and in vivo, showing significant protective effects in AA animal model.
2. Materials and Methods
2.1. Reagents
Restriction endonucleases, Taq polymerase, and T4 DNA Ligase were purchased from TaKaRa (Dalian, China). Isopropyl--D-thiogalactoside (IPTG) was from Sigma (USA). Guanidine hydrochloride and Tris-HCl were from Serva (Germany). The pQE30 prokaryotic expression vector was stored in our laboratory. His-tag affinity column was obtained from Novagen (Germany). Five-liter fermentor was from B. Braun (Germany). Goat anti-human BAFF polyclonal antibody was from Santa Cruz Biotechnology (California, USA) and HRP-labeled rabbit anti-goat IgG was from Zhongshan Golden Bridge Biotechnology Co. Ltd. (Beijing, China). Complete and incomplete Freund’s adjuvants were from Sigma (Saint Louis, Missouri, USA). Nucleotide oligos were synthesized by BioAsia (Shanghai, China). All other chemicals were of analytical grade.
2.2. Animals
Male Balb/c mice and Sprague-Dawley (SD) rats were purchased from the National Rodent Laboratory Animal Resource (Shanghai, China) and housed in a room with controlled ambient temperature (°C) and humidity (%). They were provided alternating 12 h periods of light and darkness. All procedures involving animals were approved by the Ethical Committee of the Institute and performed according to the Principles of Laboratory Animal Care (China).
2.3. Construction, Expression, and Purification of Recombinant PADRE-BAFF Molecules
The DNA coding for T helper epitope PADRE (AKFVAAWTLKA) was obtained by oligonucleotide synthesis according to the sequences 5′-GATCC ATGGCCAAATTTGTTGCTGCCTGGACCCTG AAAGCTG-3′ and 5′-AA T TCAGCTTTCAGGGTCCAGG CAGCAACAAATTTGGCCATG-3′. The sequences were designed to include BamH I and EcoR I restriction sites (underlined). The gene of soluble BAFF was amplified from human leukocyte cDNA library with the following primers: 5′-GCGGAATTCGCCGTTC AGGGTCCAGAAG-3′ (forward) and 5′-GCGCTGCAGTCACAGCAGTTTC AATGCACCA-3′ (reverse). EcoR I and Pst I restriction sites are underlined. The PADRE oligonucleotides (annealed) and PCR products were inserted into pQE30 vector digested with BamH I and Pst I. The construct of resulting plasmid pQPB (pQE30-PADRE-BAFF) was confirmed by DNA sequencing.
To express PADRE-BAFF protein, pQPB plasmid was transformed into BL21 (DE3) competent cells. A positive clone was inoculated into 5 mL Luria-Bertani (LB) medium supplemented with ampicillin (100 μg/mL) and grown with 200 rpm shaking overnight at 37°C. Then, 50 μL of culture was transferred into 5 mL of fresh LB medium and PADRE-BAFF expression was induced by adding 1 mM of IPTG when the reached 0.5. After incubation at 37°C for 4 h, 1 mL of culture was collected and analyzed by SDS-PAGE to detect the expression of the recombinant vaccine.
For large scale purification, fermentation was performed using a 5 L fermentor as previously described [26]. The induced bacteria were harvested by centrifugation. Cell paste (100 g) was suspended in STE and sonicated on ice. Then, inclusion bodies (IBs) were solubilized in buffer A (7 M Guanidine HCl, 0.1 M NaH2PO4, and 0.01 M Tris-HCl pH 8.0) and loaded to a His-tag affinity chromatography column equilibrated with the same buffer. The column was eluted with buffer A and buffer B (7 M Guanidine HCl, 0.1 M NaH2PO4, and 0.01 M Tris-HCl pH 6.3) thoroughly to remove all unbound proteins and PADRE-BAFF was finally eluted with buffer B containing 250 mM imidazole. The purified IBs were refolded by dialysis against PBS at 20°C for 8 h twice. The refolded proteins were collected by centrifugation to remove the pellet and stored at −70°C for later use.
2.4. Characterization of Recombinant PADRE-BAFF
To analyze the purity of PADRE-BAFF, size exclusion chromatography- (SEC-) HPLC was performed on a Waters’ HPLC system. The sample in PBS was injected into a 7.5 × 300 mm G2000SW column (TOSOH) at a flow rate of 0.5 mL/min and peaks were detected by monitoring at 280 nm. The purity of proteins was calculated as a percentage of the total peak area detected.
For Western blot, samples were transferred to PVDF membrane after SDS-PAGE using a wet transfer system. Western blot analysis was carried out using a goat anti-human BAFF polyclonal antibody, followed by an HRP-labeled rabbit anti-goat IgG. The target proteins were finally visualized with an enhanced chemiluminescence (ECL, Amersham).
The bioactivity of purified PADRE-BAFF was determined by assessing its effect on B cell line proliferation. In brief, Raji cells were collected and suspended at in RPMI 1640 medium supplemented with 10% heat-inactivated fetal calf serum (FCS). Cells were seeded in 96-well plates (/well) in triplicate and cultured in presence of 2 g/mL of goat anti-human IgM at 37°C in 5% CO2 in humid air. For proliferation assay, serially diluted PADRE-BAFF was added 6 h later, and standard BAFF and 1640 medium were used as positive and negative controls, respectively. After 66 h incubation, 20 L of MTT (0.5 mg/mL) was added and the plates were centrifuged 4 h later. The supernatants were discarded, and 100 L of DMSO was added. Samples were incubated at room temperature for 10 min and measured at 570 nm using a Bio-Rad plate reader to calculate the growth rate. Growth rate .
2.5. Induction of AA in Rats
The AA animal model was developed by inoculating 0.1 mL of complete Freund’s adjuvant (CFA) into the hind metatarsal rat footpad of each foot. The day of CFA injection was designated day 0. From day 7, rats were examined daily for the onset of AA by assessing three parameters: body weight, paw swelling, and clinical score. Body weight was measured every other day as an indicator of systemic inflammation. For determination of paw swelling, the thickness of each hind paw was monitored three times a week by using a caliper. The clinical score was calculated on the basis of the following scoring system: 0, normal; 1, slight swelling and/or erythema; 2, moderate erythema and/or swelling; 3, severe erythema and/or swelling; 4, complete erythema and swelling of toes or fingers and ankle or wrist and inability to bend the ankle or wrist.
2.6. Immunization of Animals with PADRE-BAFF
PADRE-BAFF was dissolved in 0.9% saline (800 μg/mL). Balb/c mice or SD rats were allocated to three groups () and subcutaneously (s.c.) immunized with 20 μg (mice) or 80 g (rats) of PADRE-BAFF with or without CFA, and saline was used in control groups. All animals were immunized at two-week intervals for three times followed by a boost given intraperitoneally (i.p.) at the sixth week. Sera were collected 10 days after the last immunization and analyzed by ELISA. Briefly, 96-well plates were coated with BAFF standards (100 ng/well) and incubated overnight at 4°C. Sera were diluted in a tenfold series (1 : 100–1 : 100,000) and loaded as primary antibodies. Peroxidase-conjugated goat anti-rat IgG was used as secondary antibody. All data were referred to a nonimmune serum and sera titers were assigned as the highest dilution that yielded an optical density greater than twice that of the nonimmune serum at the same dilution.
AA was induced when rats developed a BAFF-specific antibodies titer as high as 1 : 100,000 after the last immunization.
The neutralization assay was performed as previously described [27]. In brief, sera samples preincubated with standard BAFF at 37°C for 30 min were used in the Raji cell proliferation assay to investigate the blockade of BAFF effect by sera.
2.7. Statistical Analysis
All data were analyzed by the Student’s -tests, and differences were considered statistically significant when the value was less than 0.05.
3. Results
3.1. Construction and Expression of PADRE-BAFF
The recombinant PADRE-BAFF was constructed by PCR and gene synthesis. The coding sequence of extracellular fragment of BAFF was amplified by PCR from human leukocyte cDNA library and fused to chemically synthesized PADRE encoding DNA sequence at N terminus (Figure 1(a)). After identifying the plasmids by enzyme digest (Figure 1(b)) and DNA sequencing, the engineered bacterium pQPB/BL21 (DE3) was cultured in a 5 L fermentor and about 100 g wet weight of cells was obtained from 1 L of culture (Figure 2(a)). The expression of PADRE-BAFF was identified by SDS-PAGE. As shown in Figure 2(b), a new band was induced in the total proteins of pQPB/BL21 (DE3) strain compared with that of the BL21 (DE3) itself. And Western blot analysis showed that the new proteins induced by IPTG could be specifically recognized by goat anti-human BAFF antibody (Figure 2(c)).

(a)

(b)

(a)

(b)

(c)

(d)
3.2. Purification and Characterization of PADRE-BAFF
Recombinant PADRE-BAFF was purified by using a His-tag affinity chromatography column as described in Section 2 (Figure 2(b)). Then, the purified protein was refolded by dialysis and stored at −70°C.
The amino acid sequencing analysis showed that the N terminal sequences of PADRE-BAFF were as follow: MRGSHHHHHHAKFVA (data not shown), which was in agreement with the theoretical sequences of PADRE-BAFF as we designed. The purity of final purified protein was analyzed by SEC-HPLC and it is over 95% (Figure 2(d)).
3.3. Detection of Antibody Induced by PADRE-BAFF
To determine whether the recombinant vaccine can effectively stimulate systemic immunity, Balb/c mice and SD rats were immunized s.c. at 2-week intervals with PADRE-BAFF. Sera were collected and specific serum binding antibodies against BAFF were detected by ELISA (Figures 3(a) and 3(b)). PADRE-BAFF could induce specific antibodies against BAFF and the antibody titer could reach a level of 1 : 100,000. Because of the high immunogenicity of PADRE, adjuvant has little effect on the immune response and no significant difference of the antibody titer can be seen between groups with or without Freund’s adjuvant (). In order to investigate the neutralizing activity of induced polyclonal antibodies, antisera were heat-inactivated at 56°C for 30 min and then incubated with standard BAFF. Results showed that the proliferation of Raji cells stimulated by standard BAFF was apparently blocked by antisera (Figure 3(c)).

(a)

(b)

(c)
3.4. Therapeutic Effect of PADRE-BAFF on AA Animal Model
The polyclonal antibodies induced by PADRE-BAFF can block the bioactivity of standard BAFF in vitro; we go to determine whether the vaccine can effectively block endogenous BAFF in vivo and can be a therapeutic agent for BAFF overexpression associated autoimmune diseases. To this end, AA was induced in SD rats and the effect of PADRE-BAFF on this model was evaluated.
SD rats were immunized four times with adjuvant-free PADRE-BAFF. One week after the last immunization, AA was induced as above. From day 7, rats were examined daily for the onset of AA by assessing body weight, paw swelling, and clinical score. As shown in Figure 4(a), arthritis symptoms can be obviously observed in both control and vaccine group rats, but the clinical symptoms of PADRE-BAFF-vaccinated mice were apparently ameliorated, as shown by the significant differences in the clinical score values.

(a)

(b)
In addition, the analysis of hind-paw swelling and the number of limbs involved indicated the amelioration of clinical symptoms in the PADRE-BAFF-vaccinated mice in comparison with the control mice (Figure 4(b)). We also examined the histologic changes in the knee joint by X-ray and images demonstrated an intense degree of decalcification and early erosion in the model group, which was not evident in the PADRE-BAFF-treated animals (Figure 5).

(a)

(b)

(c)
4. Discussion
It is well known that B cells play important roles in RA. B cell depletion therapy and dampened B cell subpopulations have shown beneficial effects in RA. As a result, B cell-related activation and survival genes have been paid more attention. BAFF is a potent regulator of B cell differentiation and survival [2, 5]. It is observed that B cell differentiation is severely perturbed in mice [6–8]. A recent study showed that BAFF gene expression and serum levels were the highest in the very early of untreated RA [28]. As more and more compelling direct evidence for BAFF overexpression in the sera as well as synovial fluid in RA patients has been gathered, BAFF is considered to be a candidate therapeutic target in RA treatment [14, 29, 30]. In this study, we constructed and expressed a BAFF autovaccine by coupling the extracellular domain of BAFF to the PADRE T helper cell epitope. We hope that the vaccine can instruct the exaggerated and uncontrolled humoral immune responses to produce BAFF neutralizing autoantibodies. And finally a new equilibrium will be reached and the immune system homeostasis will be rebuilt when the redundant endogenous BAFF and B cell subpopulations were removed.
Adjuvants are usually essential in autovaccines development, because it is usually difficult to effectively break tolerance against autopathological molecules and induce high titer of autoantibodies without an adjuvant. Unfortunately, adjuvants may have side effects in clinics [31]. For instance, the widely used aluminum adjuvants can cause pain, erythema, and swelling at the site of injection for several days [32]. Patients who receive aluminum adjuvants may show symptoms of myalgia, arthralgia, fatigue, or even serious neurological diseases such as multiple sclerosis [33]. Consequently, autovaccine immunization without adjuvants is more preferable. The autovaccine PADRE-BAFF that we used in this study owned high immunogenicity and can induce high titer of BAFF antibodies in mice and rats without adjuvant. When used in AA model in rats, adjuvant-free PADRE-BAFF apparently ameliorated the syndrome and had an obvious therapeutic action. Although we have evaluated the immunogenicity and preventive effects of PADRE-BAFF in animal models, before being used in clinical trials, the immunogenicity and therapeutic effects of this recombinant autovaccine should be systemically judged in different human tissue associated models. So we will further investigate its therapeutic effects in RA synovium/SCID chimeric model.
5. Conclusions
In the present study, we developed an adjuvant-free autovaccine of BAFF, a key molecule in regulating B lymphocyte homeostasis. The recombinant vaccine PADRE-BAFF was expressed in E. coli at high level as inclusion bodies. After purification and renaturation, the vaccine was used to immunize mice and rats and it can induce high titer of polyclonal antibodies to BAFF. We further evaluated the histologic changes, paw swelling, and clinical score of AA rats with or without PADRE-BAFF treatment; results showed that the adjuvant-free administration of the PADRE-BAFF vaccine apparently ameliorated symptoms of AA in rats. All these data demonstrate that the BAFF vaccines are useful for further research, especially for the in vitro preclinical evaluation of their potential as biological BAFF neutralizing agents.
Conflict of Interests
The authors declare that there is no conflict of interests regarding the publication of this paper.
Authors’ Contribution
Guo-dong Feng and Xiao-chang Xue contributed equally to this paper.
Acknowledgment
This study was supported by Grants from the National High Technology Research and Development Program of China (no. 2012AA02A407).
References
- P. A. Moore, O. Belvedere, A. Orr et al., “BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator,” Science, vol. 285, no. 5425, pp. 260–263, 1999. View at: Publisher Site | Google Scholar
- F. MacKay and P. Schneider, “Cracking the BAFF code,” Nature Reviews Immunology, vol. 9, no. 7, pp. 491–502, 2009. View at: Publisher Site | Google Scholar
- K. Yoshimoto, Y. Takahashi, M. Ogasawara et al., “Aberrant expression of BAFF in T cells of systemic lupus erythematosus, which is recapitulated by a human T cell line, Loucy,” International Immunology, vol. 18, no. 7, pp. 1189–1196, 2006. View at: Publisher Site | Google Scholar
- M. B. Litinskiy, B. Nardelli, D. M. Hilbert et al., “DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL,” Nature Immunology, vol. 3, no. 9, pp. 822–829, 2002. View at: Publisher Site | Google Scholar
- S. G. Tangye, V. L. Bryant, A. K. Cuss, and K. L. Good, “BAFF, APRIL and human B cell disorders,” Seminars in Immunology, vol. 18, no. 5, pp. 305–317, 2006. View at: Publisher Site | Google Scholar
- B. Schiemann, J. L. Gommerman, K. Vora et al., “An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway,” Science, vol. 293, no. 5537, pp. 2111–2114, 2001. View at: Publisher Site | Google Scholar
- J. S. Thompson, P. Schneider, S. L. Kalled et al., “BAFF binds to the tumor necrosis factor receptor-like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population,” The Journal of Experimental Medicine, vol. 192, no. 1, pp. 129–135, 2000. View at: Publisher Site | Google Scholar
- P. Schneider, H. Takatsuka, A. Wilson et al., “Maturation of marginal zone and follicular B cells requires B cell activating factor of the tumor necrosis factor family and is independent of B cell maturation antigen,” The Journal of Experimental Medicine, vol. 194, no. 11, pp. 1691–1697, 2001. View at: Publisher Site | Google Scholar
- S. D. Khare, I. Sarosi, X. Xia et al., “Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice,” Proceedings of the National Academy of Sciences of the United States of America, vol. 97, no. 7, pp. 3370–3375, 2000. View at: Publisher Site | Google Scholar
- J. A. Gross, J. Johnston, S. Mudri et al., “TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease,” Nature, vol. 404, no. 6781, pp. 995–999, 2000. View at: Publisher Site | Google Scholar
- J. Groom, S. L. Kalled, A. H. Cutler et al., “Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjögren's syndrome,” The Journal of Clinical Investigation, vol. 109, no. 1, pp. 59–68, 2002. View at: Publisher Site | Google Scholar
- H. Joo, C. Coquery, Y. Xue et al., “Serum from patients with SLE instructs monocytes to promote IgG and IgA plasmablast differentiation,” The Journal of Experimental Medicine, vol. 209, pp. 1335–1348, 2012. View at: Google Scholar
- T. Koyama, H. Tsukamoto, Y. Miyagi et al., “Raised serum APRIL levels in patients with systemic lupus erythematosus,” Annals of the Rheumatic Diseases, vol. 64, no. 7, pp. 1065–1067, 2005. View at: Publisher Site | Google Scholar
- S. Tan, D. Xu, V. Roschke et al., “Local production of B lymphocyte stimulator protein and APRIL in arthritic joints of patients with inflammatory arthritis,” Arthritis and Rheumatism, vol. 48, no. 4, pp. 982–992, 2003. View at: Publisher Site | Google Scholar
- M. Krumbholz, D. Theil, T. Derfuss et al., “BAFF is produced by astrocytes and up-regulated in multiple sclerosis lesions and primary central nervous system lymphoma,” The Journal of Experimental Medicine, vol. 201, no. 2, pp. 195–200, 2005. View at: Publisher Site | Google Scholar
- M. Dall'Era, E. Chakravarty, D. Wallace et al., “Reduced B lymphocyte and immunoglobulin levels after atacicept treatment in patients with systemic lupus erythematosus: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating trial,” Arthritis and Rheumatism, vol. 56, no. 12, pp. 4142–4150, 2007. View at: Publisher Site | Google Scholar
- P. P. Tak, R. M. Thurlings, C. Rossier et al., “Atacicept in patients with rheumatoid arthritis: results of a multicenter, phase Ib, double-blind, placebo-controlled, dose-escalating, single- and repeated-dose study,” Arthritis and Rheumatism, vol. 58, no. 1, pp. 61–72, 2008. View at: Publisher Site | Google Scholar
- X. Jin and C. Ding, “Belimumab—an anti-BLyS human monoclonal antibody for rheumatoid arthritis,” Expert Opinion on Biological Therapy, vol. 13, pp. 315–322, 2013. View at: Google Scholar
- L. Quan, G. M. Thiele, J. Tian, and D. Wang, “The development of novel therapies for rheumatoid arthritis,” Expert Opinion on Therapeutic Patents, vol. 18, no. 7, pp. 723–738, 2008. View at: Publisher Site | Google Scholar
- A. Finnegan, S. Ashaye, and K. M. Hamel, “B effector cells in rheumatoid arthritis and experimental arthritis,” Autoimmunity, vol. 45, pp. 353–363, 2012. View at: Google Scholar
- J. U. Scher, “B-cell therapies for rheumatoid arthritis,” Bulletin of the NYU Hospital for Joint Diseases, vol. 70, pp. 200–203, 2012. View at: Google Scholar
- D. R. Chen and P. L. Cohen, “Living life without B cells: is repeated B-cell depletion a safe and effective long-term treatment plan for rheumatoid arthritis?” International Journal of Clinical Rheumatology, vol. 7, no. 2, pp. 159–166, 2012. View at: Publisher Site | Google Scholar
- A. M. Waterston, L. Gumbrell, T. Bratt et al., “Phase I study of TNFα AutoVaccine in patients with metastatic cancer,” Cancer Immunology, Immunotherapy, vol. 54, no. 9, pp. 848–857, 2005. View at: Publisher Site | Google Scholar
- I. Dalum, M. R. Jensen, P. Hindersson, H. I. Elsner, and S. Mouritsen, “Breaking of B cell tolerance toward a highly conserved self protein,” Journal of Immunology, vol. 157, no. 11, pp. 4796–4804, 1996. View at: Google Scholar
- I. Dalum, M. R. Jensen, K. Gregorius, C. M. Thomasen, H. I. Elsner, and S. Mouritsen, “Induction of cross-reactive antibodies against a self protein by immunization with a modified self protein containing a foreign T helper epitope,” Molecular Immunology, vol. 34, no. 16-17, pp. 1113–1120, 1997. View at: Publisher Site | Google Scholar
- X. Xue, Z. Wang, Z. Yan, J. Shi, W. Han, and Y. Zhang, “Production and purification of recombinant human BLyS mutant from inclusion bodies,” Protein Expression and Purification, vol. 42, no. 1, pp. 194–199, 2005. View at: Publisher Site | Google Scholar
- X. Xue, G. Feng, M. Li et al., “Amelioration of experimental autoimmune encephalomyelitis by BLyS autovaccine,” Vaccine, vol. 26, no. 23, pp. 2873–2881, 2008. View at: Publisher Site | Google Scholar
- R. A. Moura, H. Canhao, J. Polido-Pereira et al., “BAFF and TACI gene expression are increased in patients with untreated very early rheumatoid arthritis,” The Journal of Rheumatology, vol. 40, no. 8, pp. 1293–1302, 2013. View at: Google Scholar
- G. S. Cheema, V. Roschke, D. M. Hilbert, and W. Stohl, “Elevated serum B lymphocyte stimulator levels in patients with systemic immune-based rheumatic diseases,” Arthritis & Rheumatism, vol. 44, pp. 1313–1319, 2001. View at: Google Scholar
- J. Ohata, N. J. Zvaifler, M. Nishio et al., “Fibroblast-like synoviocytes of mesenchymal origin express functional B cell-activating factor of the TNF family in response to proinflammatory cytokines,” Journal of Immunology, vol. 174, no. 2, pp. 864–870, 2005. View at: Google Scholar
- L. S. Jacobson, H. Lima, M. F. Goldberg et al., “Cathepsin-mediated necrosis controls the adaptive immune response by Th2-associated adjuvants,” The Journal of Biological Chemistry, vol. 288, no. 11, pp. 7481–7491, 2013. View at: Google Scholar
- T. Jefferson, M. Rudin, and C. di Pietrantonj, “Adverse events after immunisation with aluminium-containing DTP vaccines: systematic review of the evidence,” The Lancet Infectious Diseases, vol. 4, no. 2, pp. 84–90, 2004. View at: Publisher Site | Google Scholar
- R. K. Gherardi, “Lessons from macrophagic myofasciitis: towards definition of a vaccine adjuvant-related syndrome,” Revue Neurologique, vol. 159, no. 2, pp. 162–164, 2003. View at: Google Scholar
Copyright
Copyright © 2014 Guo-dong Feng et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.