Beta-Catenin and Epithelial Tumors: A Study Based on 374 Oropharyngeal Cancers

Santoro, Angela; Pannone, Giuseppe; Papagerakis, Silvana; McGuff, H. Stan; Cafarelli, Barbara; Lepore, Silvia; De Maria, Salvatore; Rubini, Corrado; Mattoni, Marilena; Staibano, Stefania; Mezza, Ernesto; De Rosa, Gaetano; Aquino, Gabriella; Losito, Simona; Loreto, Carla; Crimi, Salvatore; Bufo, Pantaleo; Lo Muzio, Lorenzo

doi:https://doi.org/10.1155/2014/948264

BioMed Research International

On this page

Abstract Introduction Materials and Methods Results and Discussion Conclusions References Copyright Related Articles

Special Issue

Cancer Diagnostic and Predictive Biomarkers

View this Special Issue

Research Article | Open Access

Volume 2014 | Article ID 948264 | https://doi.org/10.1155/2014/948264

Beta-Catenin and Epithelial Tumors: A Study Based on 374 Oropharyngeal Cancers

Angela Santoro,¹Giuseppe Pannone,²Silvana Papagerakis,³H. Stan McGuff,⁴Barbara Cafarelli,⁵Silvia Lepore,⁶Salvatore De Maria,⁷Corrado Rubini,⁸Marilena Mattoni,²Stefania Staibano,⁹Ernesto Mezza,⁹and Gaetano De Rosa⁹ et al.

Academic Editor: Franco M. Buonaguro

Received01 Aug 2013

Revised26 Oct 2013

Accepted17 Nov 2013

Published08 Jan 2014

Abstract

Introduction. Although altered regulation of the Wnt pathway via beta-catenin is a frequent event in several human cancers, its potential implications in oral/oropharyngeal squamous cell carcinomas (OSCC/OPSCC) are largely unexplored. Work purpose was to define association between beta-catenin expression and clinical-pathological parameters in 374 OSCCs/OP-SCCs by immunohistochemistry (IHC). Materials and Methods. Association between IHC detected patterns of protein expression and clinical-pathological parameters was assessed by statistical analysis and survival rates by Kaplan-Meier curves. Beta-catenin expression was also investigated in OSCC cell lines by Real-Time PCR. An additional analysis of the DNA content was performed on 22 representative OSCCs/OPSCCs by DNA-image-cytometric analysis. Results and Discussion. All carcinomas exhibited significant alterations of beta-catenin expression (). Beta-catenin protein was mainly detected in the cytoplasm of cancerous cells and only focal nuclear positivity was observed. Higher cytoplasmic expression correlated significantly with poor histological differentiation, advanced stage, and worst patient outcome (). By Real-Time PCR significant increase of beta-catenin mRNA was detected in OSCC cell lines and in 45% of surgical specimens. DNA ploidy study demonstrated high levels of aneuploidy in beta-catenin overexpressing carcinomas. Conclusions. This is the largest study reporting significant association between beta-catenin expression and clinical-pathological factors in patients with OSCCs/OPSCCs.

1. Introduction

OSCCs and OPSCCs represent one of the major health issues, with over 200,000 new cases reported worldwide annually. Despite significant improvements in the early screening and diagnosis of these cancers, the 5-year-disease-free survival of those patients remains unacceptably poor. For many years, the main prognostic factors of SCC have been the conventional grading, staging, and site of tumor [1–3]. Nowadays, the goal of the scientific research is to find new biological markers able to define the “tumor biological fingerprint” and to identify the molecular key players that are involved in oropharyngeal carcinogenesis [4, 5]. Beta-catenin is a multifunctional protein expressed on the surface of epithelial cells, acting as a structural component of the E-cadherin-related cell adhesion system [6]. In this way beta-catenin has a crucial role in creation and maintenance of epithelial stability by regulating cell growth and adhesion between cells. Recent evidence suggests that beta-catenin also plays other important functional roles, including the control of cell polarization, differentiation, “stemness,” and cell motility [7, 8]. As a cause of genomic instability through aneuploidy, beta-catenin plays an important role in tumour development and aggressiveness [7–10]. Constitutive activation of the Wnt signaling pathway is a major etiological factor for many cancers [11–14]. Beta-catenin is the key mediator of the Wnt pathway. When the Wnt signaling is in its resting state, beta-catenin is phosphorylated by glycogen synthase kinase 3β (GSK3-β) within a protein complex that also includes casein kinase 1, adenomatous polyposis coli (APC), and Axin. Phosphorylated beta-catenin is immediately degraded via the ubiquitin proteasome pathway. WNT binding to Frizzled (Fz) results in the activation of Dishevelled (Dsh), which inhibits the activity of GSK3-β, resulting in dephosphorylation and stabilization of beta-catenin, enabling it to accumulate within the nucleus, where it interacts with members of the T-cell factor/lymphocyte enhancer factor (TCF/LEF) family and activate the expression of critical target genes governing cell fate, proliferation, and other processes in several types of cancer [15–20]. Moreover, although the role of the epithelial-to-mesenchymal transition (EMT) phenomenon in development and/or tumor progression and metastasis is still controversial, it is well known that beta-catenin and the cadherin switching can have a profound effect on cell phenotype and behavior [21, 22]. Previous studies have shown that CTNNB1, the gene of beta-catenin, together with APC and Axin are frequently mutated in different types of human cancers [7]. Although mutations in APC or CTNNB1 are rarely found in OSCC cell lines and in OSCC, catenin delocalization has been reported in premalignant and malignant lesions of the oral cavity and in OSCC [23, 24]. Other studies have demonstrated that aberrant expression of beta-catenin is inversely correlated with differentiation and is significantly associated with invasion and poor prognosis [25, 26]. In addition, we have recently reported that the cytoplasmic/nuclear accumulation of beta-catenin could be considered the final step of constitutive activation of WNT signal by epigenetic methylation of WNT inhibitors [27].

The aim of the present study, that retrospectively investigates a large series of oral and oropharyngeal carcinomas, occurred in Italy and North America, is to evaluate the expression profile of beta-catenin in OSCC/OPSCC and to assess its association with clinical and histopathological parameters.

2. Materials and Methods

2.1. Study Population

Upon approval by the Ethical Committees of all the participants institutions, we identified 374 OSCCs/OPSCCs, selected from the Anatomic Pathology informatics archives of three different hospitals: “Ospedale Regionale Torrette—Ancona (1990–2007),” “Istituto Nazionale per lo studio e la cura dei Tumori G. Pascale”—Napoli (1996–2009), and the Department of Pathology, Medical School, University of Texas Health Science Center at San Antonio, Texas (1995–2007). Patients from these distinct geographical areas were previously untreated and received surgical and/or radio/chemotherapeutic treatment only with curative intention. Samples of human oropharyngeal cancers were obtained with the signed informed consent of all patients. Demographical and clinical-pathological characteristics of the study population were summarized in Table 1. The mean followup time of the studied cases was 39.41 months. Survival rate was calculated from the time of diagnosis to the date of the latest clinical follow-up or to patient’s death due to disease or to other causes. An adequate series of normal oral and oropharyngeal mucosa specimens was used as controls for the comparative analyses. Finally, in 22 representative OSCCs one fragment of the tissue was immediately fresh frozen in liquid nitrogen and stored at 80°C for quantitative analysis by Real Time RT-PCR. The residual tissue was fixed in formalin solution for the routine histopathological examination and DNA ploidy analysis.

2.2. Immunohistochemistry

374 OSCCs/OPSCCs were quantitatively and qualitatively analyzed by immunohistochemistry for beta-catenin expression. Immunohistochemical analysis was performed by using Ventana Benchmark autostainer and/or manual standard linked streptavidin-biotin horseradish peroxidase technique (LSAB-HRP), according to the best protocol for the antibody tested in our laboratory and as previously described [28–30]. We used primary monoclonal rabbit anti-beta-catenin (clone 6B3; Cell Signaling Technology, Danvers, MA) diluted 1 : 150 and incubated overnight. Negative control slides without primary antibody were included for each staining. The results of the immunohistochemical staining were evaluated separately by two observers. Immunostained cells were counted in at least 10 high power fields (HPF) analyzed with an optical microscope (OLYMPUS BX41, at x40). The topographical staining pattern was evaluated and recorded as nuclear (N), membranous (M), cytoplasmic (C), or mixed, with prevalent membranous (M/C) or prevalently cytoplasmic (C/M) staining. For each case, the cumulative percentage of positive cells among all sections examined was determined. Interrate reliability between the two investigators blindly and independently examining the immunostained sections was assessed by the Cohen’s test, yielding values higher than 0.70 in almost all instances.

2.3. Cell Lines

Cell lines derived from OSCCs and normal keratinocytes have been used for Real-Time PCR analysis. The cell lines used were (1) NCTC 2544 (normal and immortalized keratinocytes originated from skin keratinocytes of human origin and obtained from Interlab Cell Line Collection, Genova, Italy); (2) KB (CCL-17 dedifferentiated cell line, originated from human oral squamous cell carcinoma and obtained from ATCC, Manassas, VA, USA); (3) OSC-20 (well-differentiated oral SCC cell line, originated from a human oral squamous cell carcinoma and kindly supplied by Professor N. Tanaka and Dr H. Kondo, Sapporo Medical School, Sapporo, Japan); (4)-(5) CAL 33 and CAL 27 (moderately differentiated oral SCC cell lines, originated from a human squamous cell carcinoma and kindly supplied by Prof. J. L. Fischel, Centre Antoine-Lacassagne, Nice, France; these cells have relatively long doubling times (35 and 43 h, resp.)).

The cell lines were cultured as monolayers at 37°C in Dulbecco’s Modified Eagles Medium (DMEM NCTC 2544, KB, CAL 27, and CAL 33) or RPMI 1640 (OSC20) supplemented with 10% fetal bovine serum (FBS), 0.075% sodium bicarbonate, and 0.6 mg/mL L-glutamine.

2.4. RNA Extraction

Total RNA was isolated by RNeasy minikit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The structural integrity of all tested total RNA samples was verified by agarose gel electrophoresis.

2.5. Reverse Transcription

Samples containing 5 μg of total RNA in a final volume of 100 μL were reversed-transcribed by avian myeloblastosis virus (AMV) reverse transcriptase (Promega, Madison, WI), according to the manufacturer’s instructions. Random hexamer primers were used and the reaction was incubated for 60 min at 42°C. The ss-cDNA obtained was used for Real-Time PCR amplification.

2.6. Real-Time PCR

Real Time PCR has been used in order to perform quantitative analysis of beta-catenin in oral cancer cell lines, normal oral keratinocytes, and representative cases of oral cancer (22 cases with paired normal oral mucosa).

Real-Time PCR analysis of beta-catenin gene expression was performed by using the iCycler apparatus (BioRad, Hercules, CA) with sequence-specific primer pairs for the gene tested: respectively, beta-catenin forward GGGATGTTCACAACCGAATTGT and beta-catenin reverse GCTACTCTTTGGATGTTTTCAATGG. Amplification of the housekeeping gene glyceraldehyde-phosphate-dehydrogenase (GAPDH) from the same samples was used as internal control. The primers used were the following: GAPDH forward, 5′-TGG TAT CGT GGA AGG ACT CAT GAC-3′ and reverse, 5′-ATG CCA GTG AGC TTC CCG TTC AGC-3′. The cDNA was serially diluted and every dilution was run in triplicate. The Real-time PCR analysis was performed by using an initial denaturation step at 95°C for 3 min, followed by 50 cycles of denaturation at 95°C for 1 s, annealing at 50°C for 10 s, elongation at 72°C for 8 s. The IQ Sybr Green SuperMix (BioRad, Hercules, CA, USA) was used for Real-Time monitoring of amplification. Briefly, amplification was performed in a total volume of 20 μL. The reaction mixture contained 10 μL of 2x IQ Sybr Green SuperMix, 0.5 μL of each primer (16 μM), and 2 μL of cDNA (or water as blank, which was always included). The Real-Time PCR products were electrophoresed on 2% agarose gel containing TAE (standard Tris-Acetate-EDTA electrophoretic buffer). The amplicons of expected size were extracted, purified, and controlled for sequence. Results were evaluated by means of ICYCLER IQ Real-Time Detection System Software (BioRad). Data were calculated on threshold cycle (Ct). We assumed = beta-catenin Ct − GAPDH Ct, = pathological − normal tissue , and the fold change of expression as . The last value represents the pathological versus normal mucosa gene expression. Differences in Ct values () reflect differences in copy number of mRNA molecules by the following formula: copies × . Mean values from three independent experiments were taken as results.

2.7. DNA Ploidy

Since we retain that the overall evaluation on DNA content should be performed only on histological cases rather than on cytological ones, our DNA ploidy analyses has been defined on 22 representative surgical samples (also analyzed by RT-PCR), in order to avoid the underestimation of the smallest cell fraction with aneuploid content. Four-μm serial sections from each case of the 22 selected OSCCs, deparaffinized in xylene and rehydrated through decreasing concentrations of alcohols, were stained with Feulgen (sulfuric fuchsin-acid) for nuclear DNA staining. The quantitative DNA-image cytometric analysis was carried out by means of a visual computer analysis system (Quantimet 500 IW analyzer, Leica, Cambridge, England; 3CCD camera DXC-95OP, Sony, Köln, Germany; Leica QWINVO200A and Leica Qploidy software). At least 200 cancer cells for each case were examined in nonconsecutive random fields of representative areas of the lesions. By using a minimum of 30 lymphocytes the following parameters were determined: (1) the normal diploid DNA content (2c); (2) the DNA deviation index (DI); (3) the 2c DI, defined as the average quadratic deviation of the diploid value; (4) the percentage of cancer cells with a DNA content higher than 5c; (5) the DNA malignancy grade. Lesions were classified as follows: (1) diploid, when more than 70% of cells with a DI ranging from 0.8 to 1.12 were detected; (2) tetraploid, when 20% or more of cells with a DI ranging from 0.8 to 1.12 and 5% or more of cells in the range 2.12 to 4.12 were found; (3) aneuploid, when 10% or more of cells with a DI distributed in all other values outside the range 1.12 to 1.8 and/or 20% or more of cells with a DI ranging from 1.12 to 1.8 were observed. The different degree of aneuploidy has been identified according to Duesberg P. classification: near diploid class with low instability, 1.5 class with high instability, near 3 class with very high instability [31].

2.8. Statistical Analyses

The data were analyzed by the Stanton Glantz statistical software 3 (MS-DOS) and Graph-Pad Prism software version 4.00 for Windows (Graph Pad software San Diego California, USA; http://www.graphpad.com/). Differences between groups were determined using the one-way analysis of variance (ANOVA) and the Student-Newman-Keuls test to evaluate the correlation between membranous, nuclear, and cytoplasmic expression of beta-catenin and clinical-pathological parameters. values <0.05 were regarded as significant.

Therefore, ordinal logistic regression was performed by SPSS 10.1 software, in order to verify the association between the presence and the impact of the two major risk factor (tobacco and alcohol, as covariates) and the different topographical intracellular pattern of beta-catenin expression (response variable) [32]. Kaplan-Meier curves were plotted for the survival analysis of the patients.

3. Results and Discussion

3.1. Study Population

To our knowledge, the present study is the largest retrospective analysis that investigates the association between expression of beta-catenin and the traditional clinicopathological parameters in oral and oropharyngeal carcinomas. Patients from distinct geographical areas and different ethnic groups (Caucasians, Blacks, and Hispanics) were included. Demographical and clinicopathological characteristics, summarized in Table 1, revealed a large population of 374 cases of squamous cell cancers, distinct for stage, histological grade, and sites. The TNM tumour extent of all cases as determined based on the clinic-pathological information (X-ray, bone scan, computed tomography, and pathological reports) was as follows: 86 cases in stage I, 72 in stage II, 124 in stage III and 92 in stage IV. Based on the histopathological examination, 62 tumors were G1, 188 were G2, and 124 were G3. Furthermore, 233 patients underwent surgery; 59 patients received surgery and radio-/chemotherapy only with curative intention; 82 patients have been treated with radiotherapy alone. During the follow-up period (with a mean of 39.41 months), 142 patients remained tumour-free and 207 patients died from disease, whereas, in 25 cases, death was from other causes independent of their cancer.

3.2. One-Way ANOVA Analysis

Immunohistochemical examination revealed a significant difference in beta-catenin expression between cancerous cells and normal epithelium (). More precisely, normal mucosa surrounding tumors displayed a characteristic membranous pattern of protein expression whereas OSCC/OPSCC cancerous cells exhibited cytoplasmic and focal nuclear beta-catenin localization (Figure 1). Only one case, described as basaloid variant of squamous cancer, has shown a marked and diffuse nuclear staining.

(a)

(b)

(c)

(d)

(e)

(f)

Figure 1

Immunohistochemical expression of beta catenin in oral cancer. (a) Normal membranous staining in oral epithelium surrounding OSCC (x400); (b) strong cytoplasmic increase with membranous overexpression in OSCC (x200); (c) cytoplasmic downregulation expression (x400); (d) strong nuclear cytoplasmic expression (x200); (e) lymph node metastasis from OSCC showing cytoplasmic expression (x40); (f) further detail of cytoplasmic expression in lymph node metastasis (x200); LSAB-HRP technique, nuclear counterstaining with haematoxylin.

Our findings have revealed the following various immunohistochemical patterns.(i)Persistent detection of membranous staining for beta-catenin was more common in the lip and palate-originated carcinomas (M, ) (Figure 2(a)), in <2 cm tumor () (Figure 2(b)), in well-differentiated cancers () (Figure 2(c)), in early stage (Stage I) tumors () (Figure 2(d)), and in patients nonusers of alcohol and/or tobacco ().(ii)Sporadic nuclear positivity for beta-catenin was predominantly observed in <2 cm tumor () (Figure 2(e)), in early stage (Stage I) tumors () (Figure 2(f)), without nodal metastases (N0) () (Figure 2(g)), and in patients nonusers of alcohol and/or tobacco (), with a better clinical outcome () (Figure 2(h)).(iii)Cytoplasmic delocalization with high expression of beta-catenin has been prevalently observed in OSCCs/OPSCCS of the tongue, trigonous, gingival mucosa, jaw, floor of the mouth, alveolar ridge, and, finally, in multifocal cancers () (Figure 3(a)). This immunohistochemical pattern was also observed in undifferentiated carcinomas () (Figure 3(b)), with lymphnode metastases (N+) () (Figure 3(c)), and with the worse clinical prognosis () (Figure 3(d)).(iv)Cytoplasmic delocalization with loss of beta-catenin was generally observed in oropharyngeal and cheek carcinomas () (Figure 3(e)), in Italian patients () (Figure 3(f)), with clinical history of tobacco, and/or alcohol consumption (for the two risk factors combined, ; for the tobacco use only, ; for the alcohol consumption only, ).

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 2

Persistent detection of membranous staining for beta-catenin (a)–(d) and sporadic nuclear staining for beta-catenin (e)–(h). Membranous expression of the study marker was more observable in the lip and palate carcinomas (M, ) (a), in <2 cm tumor () (b), and in well-differentiated cancers () (c), in early stage (St I) tumours () (d). Sporadic nuclear positivity for beta-catenin was more observable in <2 cm tumor () (e), in early stage (St I) tumours () (f), without nodal metastases (N0) () (g), and with a better clinical followup () (h).

(a)

(b)

(c)

(d)

(e)

(f)

Figure 3

Cytoplasmic delocalization with high expression of beta-catenin (a)–(d) and cytoplasmic delocalization of beta-catenin with immunostaining absence of marker (e)-(f). Cytoplasmic delocalization with high expression of beta-catenin has been prevalently observed in OSCCs/OPSCCS of the tongue, trigonous, gingival mucosa, jaw, and in the tumors sited on the floor of the mouth, on the alveolar ridge, and, finally, in the multifocal neoplasias () (a). This immunohistochemical pattern was also observed in undifferentiated carcinomas () (b), with clinical history of lymph nodal metastases (N+) () (c), and with worse prognosis () (d). Cytoplasmic delocalization with loss of beta-catenin was, generally, reported in oropharyngeal carcinomas and cheek cancer () (e), in Italian patients () (f).

3.3. Multiple-Way ANOVA

Comparing dependent variable beta-catenin expression to different independent variables as gender, ethnic group, age, anatomic sites, tumor diameter, histological grade, T, N, M, type of treatment, and presence of local relapse, we have also performed a multiple-way ANOVA that revealed the following findings that were statistically significant. Various levels of membranous and cytoplasmic beta-catenin expression were observed according to the ethnicity, anatomic site, histologic grade, and type of treatment. Absence of staining was found in great percentage in Caucasians (25.49%). Various levels of beta-catenin nuclear expression were observed according to tumor size and presence of local recurrence.

3.4. Ordinal Logistic Regression

Ordinal logistic regression confirms that tobacco and alcohol-related cancers are associated to delocalization with complete loss of expression of the studied marker. In contrast, the nuclear, cytoplasmic and membranous beta-catenin expression seems not to be correlated with the exposure to these risk factors in oral and oropharyngeal carcinogenesis.

3.5. Survival Analyses

Based on the survival analyses and as confirmed by the Kaplan Meyer curves, our study has revealed the tumoral stage as a classic clinicopathologic parameter with significant prognostic value. More precisely, patients with advanced stages carcinomas had a higher mortality than patients with localized neoplasms (data not shown). Overall survival curves have also revealed that primary tumours of the trigone, floor of the mouth, tongue, and multiple sites expressed the higher levels of morbidity (data not shown). By Kaplan-Meier curves, survival estimates have shown that OSCCS/OPSCCs overexpressing beta-catenin (cut off >60%) are characterized by a worse prognosis, in terms of overall survival (; survival median of 28 months in high expressing tumors versus 66 months in low expressing OSCCs/OPSCCs) (Figure 4(a)) and disease-free survival, with a more evident tendency to relapse and metastasis (; survival median of 20 months in high expressing tumors versus 30 months in low expressing OSCCs/OPSCCs) (Figure 4(b)). Moreover, the Kaplan-Meier curves have also underlined the statistically significant association between beta-catenin overexpression, high degree of differentiation (OS, ; DFS, ), and advanced stage (OS and DFS, ) (data not shown).

(a)

(b)

Figure 4

Kaplan-Meier curves ((a) overall survival and beta-catenin expression; (b) disease free survival and beta-catenin expression). Survival estimates have shown that OSCCS/OPSCCs overexpressing beta-catenin (cut-off >60%) are characterized by a worse prognosis, in terms of overall survival (; survival median of 28 months in high expressing tumors versus 66 months in low expressing OSCCs/OPSCCs) (a) and disease-free survival, with a more evident tendency to relapse and metastasis (; survival median of 20 months in high expressing tumors versus 30 months in low expressing OSCCs/OPSCCs) (b).

3.6. RT-PCR (Quantitative) on Cell Lines

The value was calculated by determining the mean value of beta-catenin expression by Real Time PCR. Beta-catenin expression showed upregulation in OSC20 cell line derived from aggressive cancer compared to normal oral epithelial cells (Table 2) (Figure 5).

3.7. RT-PCR (Quantitative) on Surgical Samples

By Real Time PCR, variations of beta-catenin mRNA expression in OSCCs/OPSCCs are present in 72% of the examined cases. In 10 out of 22 cases (45%) a significant increase of beta-catenin mRNA was observed. Interestingly, among these 10 overexpressing beta-catenin cases, 50% had lymphnode metastases. On the other hand, 27% of tumors displayed a decrease in beta-catenin mRNA expression.

3.8. DNA Ploidy

In our analysis, almost all the cases displayed different grade of aneuploidy, from hyperdiploidy to tetraploidy, multiploidy, and hypodiploidy. Euploid cancers represent only a minority (9.67%). Therefore, our study on DNA ploidy has revealed a potential association between beta-catenin upregulation and the altered DNA content in cancer samples. Two OSCCs groups were identified by the RT-PCR evaluation (Figure 6):(i)high-expressing beta-catenin cancers showing high aneuploidy degree (prevalently multiploid, followed by hyperdiploid and highly heterogeneous tumors) and lymph node metastases in T1 tumors,(ii)low-expressing beta-catenin cancers with lower aneuploidy degree (prevalently hyperdiploid, followed by lower proportion of multiploid and tetraploid tumors) and no lymph node metastases in T1 tumors.Squamous cell carcinoma is the most frequent malignant tumor of the oral and oropharyngeal cavity [26, 33]. The five-year survival rate for patients with OSCC/OPSCC in developed countries still remains very poor (of a dismal 40–50%) and has not improved over the past decades, despite advances in detection and therapy. Thus preventive approaches before the development of invasive cancer are highly desirable and novel strategies to reduce cancer incidence are currently pursued worldwide. The molecular mechanisms involved in the OSCC/OPSCC carcinogenesis are not well understood, nor their genetic profile has been fully characterized [34–36]. Abnormal cell adhesion is a peculiar feature of cancer diseases and represents a crucial point in tumor development and progression. Beta-catenin, taking part in the tightly orchestrated WNT pathway, is a crucial protein able to coordinate the expression and function of several downstream molecules [37]. It is well known that alteration in beta-catenin expression may also lead to aneuploidy and chromosome aberrations [31, 38–40]. Beta-catenin is widely expressed in proliferating normal epithelia and in numerous human cancers [7]. Recent studies have identified beta-catenin as a cancer-susceptibility gene [41]. Any type of aberration at different levels (genic mutation, epigenetic alteration of WNT pathway members) may lead to protein overexpression, detectable in the nucleus of numerous malignant cells, thus resulting in abnormal activation of cell proliferation and migration [42, 43].

Figure 6

Beta-catenin and DNA ploidy in OSCC. Two OSCCs groups were obtained by RT-PCR esteeming: (i) high-expressing beta-catenin cancers (a) showing high aneuploidy degree (prevalently multiploid, followed by hyperdiploid and highly heterogeneous tumors) and lymph node metastases in T1 tumors; (ii) low-expressing beta-catenin cancers (b) with lower aneuploidy degree (prevalently hyperdiploid, followed by lower proportion of multiploid tumor, and tetraploid ones) and no lymph node metastases in T1 tumors.

In a recent work [27] we demonstrated that other mechanisms, different from genic mutation, such as epigenetic methylation of WNT inhibitors, can induce the constitutive activation of WNT signal with intracellular accumulation of beta-catenin. Moreover, various metabolic pathways, besides the well-known WNT, can determine the intracellular delocalization of beta-catenin. In fact, various studies have reported that EGF and TGFβ can induce the phosphorylated form of p68 to bind beta-catenin, resulting in nuclear translocation of the latter with the activation of numerous downstream genes. According to other studies, MET, Fer, or Fyn kinase can also cause beta-catenin phosphorylation on Tyr 142 residue and its nuclear translocation. In fact, in this activated status beta-catenin would lose bond affinity for E-cadherin and alpha-catenin, increasing the strength of association with the transcriptional factor BCL9-2 [21]. Wilding et al. [44] showed that EGFR overexpression correlates with perturbation of the E-cadherin/catenin complex seen in the human papillomavirus HPV-16 E6- and E7-transfected keratinocytes, which may indicate a possible functional interaction between growth regulatory factors and adhesion molecules, particularly in a subset of virus infected cancers.

Considering all these data, we can postulate that beta-catenin could be involved in different molecular pathways and that other proteins could act as key components in the activation of the Wnt/beta-catenin signaling that occurs during OSCC/OPSCC cancer progression. Reduced levels of membrane-bound E-cadherin and/or γ-catenin and cytoplasmic accumulation of beta-catenin have been often observed in OSCCs/OPSCCs, indicating that Wnt signaling is activated in this disease and suggesting that the activation could be via an alternative pathway [30, 45].

Several groups have reported that the intracellular distribution of beta-catenin is different in oral neoplastic cells than in normal mucosa. Whereas beta-catenin is localized exclusively to the cell membrane in normal oral mucosal epithelium, this membrane-bound expression is absent or diminished in neoplastic cells, associated with a corresponding increase in its cytoplasmic localization [23, 24, 26].

Our work has highlighted the presence of four different immunohistochemical patterns: (1) persistent detection of membranous staining for beta-catenin, predominantly in G1 cancers, in stage I tumors, and in patients unexposed to alcohol and tobacco; (2) sporadic nuclear positivity for beta-catenin in early stage (St I) tumors and in patients unexposed to alcohol and tobacco, with a better clinical followup; (3) cytoplasmic delocalization with high expression of beta-catenin, observed in undifferentiated carcinomas with clinical positivity of lymph node metastases and with worse prognosis; (4) cytoplasmic delocalization with loss of beta-catenin, predominantly in oropharyngeal carcinomas with clinical history of tobacco and/or alcohol consumption. Ordinal logistic regression confirmed that tobacco and alcohol-related cancers are associated to beta-catenin complete loss of expression. Nuclear, cytoplasmic, and membranous expression of beta-catenin seems not to be associated with tobacco and/or alcohol consumptions, well-known risk factors in oral and oropharyngeal carcinogenesis. Therefore, we postulate that, in these patterns of protein expression, other carcinogenetic events may play a role in the intracellular distribution of beta-catenin.

There is substantial epidemiologic and molecular evidence to support the causal association between human papillomavirus (HPV) and a subset of oropharyngeal cancers [46–48]. Activation of Wnt pathway by viral oncoproteins has been already reported for Epstein Barr virus (EBV) and Kaposi’s sarcoma-associated herpesvirus [49]. In the case of Kaposi’s sarcoma-associated herpesvirus, it is the encoded latency-associated nuclear antigen protein that regulates the nuclear accumulation of GSK3-β [50]. In EBV-associated nasopharyngeal carcinoma, nuclear accumulation of beta-catenin has been proposed to occur through the activation of the phosphoinositide 3-kinase/AKT pathway by latent membrane proteins (LMP) 1 and 2A EBV proteins [51]. In a recent work Rampias et al. detected increased beta-catenin transcriptionally active protein levels in HPV16-positive-associated oropharyngeal squamous cell [52]. They also observed that, in HPV16-negative oropharyngeal squamous carcinomas, beta-catenin was mainly localized at the cell membrane. On the other hand, in HPV16-positive oropharyngeal squamous carcinomas, beta-catenin was detected in the cytoplasm and nucleus. In the present study we have considered as risk factors for OSCC/OPSCC only the presence/absence of tobacco/alcohol consumption and by ordinal logistic regression we have correlated them with a specific pattern of protein expression. In previous works, we have also investigated the prevalence on HPV virus in oral and oropharyngeal cancers [53], the golden standard method of HPV detection [54], and the prognostic role of other important proteins that are functionally interacting with beta-catenin [55–57]. The complex molecular mechanism by which beta-catenin relates to other parameters with potential prognostic or diagnostic value like viruses (e.g., HPV) and various oncogenes and tumor suppressor genes (p16, EGFR, p53, etc.) should make the object of further investigations on a large study sample.

The current literature on the prognostic role of beta-catenin has been limited by small series with either short follow-up period or lacking detailed clinic-pathologic data. This current study confirms and extends our previous findings that have indicated that beta-catenin displayed intracellular delocalization in OSCCs, which was correlated with development of local recurrences [30].

To our knowledge, the present study is the largest retrospective analysis that investigates the association between expression of beta-catenin and the traditional clinicopathological parameters in OSCC/OPSCCs of different grade and stage. This study combines different molecular diagnostic methods, such as immunohistochemistry, Real-Time quantitative RT-PCR, and DNA cytometric analysis, in tumor specimens and cell lines. Using this combinatory approach, we have revealed a prognostic value for cytoplasmic and nuclear beta-catenin. Our results obtained from quantitative RT-PCR and DNA cytometric analyses let us postulate that the abnormal beta-catenin intracellular delocalization could be associated with a higher aneuploidy degree, in support of its known role in chromosomal instability.

Cancer of the oral cavity and oropharynx remains a complex problem in pathogenesis, prevention, and treatment and there is a critical need for accurate prognostic biomarkers. Our line of investigations provides strong evidences in support of the prognostic value of beta-catenin and its relevance to the clinical practice in terms of diagnostic strategy and management of OSCCs/OPSCCs to early differentiate among various pathological entities. Further studies on independent series are required in order to establish a significant prognostic role for beta-catenin expression in these types of cancers.

4. Conclusions

Our study focuses on better understanding the crucial role of beta-catenin in OSCC/OPSCC carcinogenesis. Our findings suggest that intracellular translocation of beta-catenin may be important in the activation of Wnt signaling in OSCC/OPSCC cancer, resulting in enhanced tumor growth and possibly more aggressive tumor behavior. There is increasing evidence that elevated beta-catenin expression in neoplastic cells may also contribute to their cancer stemness potential [58, 59]. In OSCCs/OPSCCs, delocalized and overexpressed beta-catenin might identify a small cell fraction with proliferative, maybe staminal, neoplastic characteristics and a tumoral group with aggressive behavior and poor prognosis. Thus, intracellular accumulation of beta-catenin expression may be an important predictor of clinical outcome for patients with OSCC/OPSCC cancer. These results could help towards development of better diagnostic and targeted therapeutic approaches that will ultimately lead to better patient survival with more personalized and less toxic treatment.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Authors’ Contribution

Angela Santoro and Giuseppe Pannone contributed equally to this work.

Acknowledgment

The author Silvana Papagerakis was supported by the Multidisciplinary Clinical Research Career Development Program as a Clinical Scholar on the CTSA Grant (UL1RR025767), University of Texas Health Science Center at San Antonio (UTHSCSA).

References

J. Wennerberg, “Predicting response to therapy of squamous cell carcinoma of the head and neck,” Anticancer Research, vol. 16, no. 4, pp. 2389–2396, 1996.
View at: Google Scholar
J. A. Woolgar, “Histopathological prognosticators in oral and oropharyngeal squamous cell carcinoma,” Oral Oncology, vol. 42, no. 3, pp. 229–239, 2006.
View at: Publisher Site | Google Scholar
T. Bundgaard, S. M. Bentzen, J. Wildt, F. B. Sørensen, H. Søgaard, and J. E. Nielsen, “Histopathologic, stereologic, epidemiologic, and clinical parameters in the prognostic evaluation of squamous cell carcinoma of the oral cavity,” Head and Neck, vol. 18, no. 2, pp. 142–152, 1996.
View at: Google Scholar
P. Choi, C. D. Jordan, E. Mendez et al., “Examination of oral cancer biomarkers by tissue microarray analysis,” Archives of Otolaryngology—Head and Neck Surgery, vol. 134, no. 5, pp. 539–546, 2008.
View at: Publisher Site | Google Scholar
Y. Oh and L. Mao, “Biomarkers in head and neck carcinoma,” Current Opinion in Oncology, vol. 9, no. 3, pp. 247–256, 1997.
View at: Google Scholar
B. M. Gumbiner and P. D. McCrea, “Catenins as mediators of the cytoplasmic functions of cadherins,” Journal of Cell Science, vol. 106, no. 17, pp. 155–158, 1993.
View at: Google Scholar
T. Takayama, H. Shiozaki, S. Shibamoto et al., “β-catenin expression in human cancers,” American Journal of Pathology, vol. 148, no. 1, pp. 39–46, 1996.
View at: Google Scholar
C. Yost, M. Torres, J. R. Miller, E. Huang, D. Kimelman, and R. T. Moon, “The axis-inducing activity, stability, and subcellular distribution of β-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3,” Genes and Development, vol. 10, no. 12, pp. 1443–1454, 1996.
View at: Google Scholar
D. L. Rimm, J. H. Sinard, and J. S. Morrow, “Reduced α-catenin and E-cadherin expression in breast cancer,” Laboratory Investigation, vol. 72, no. 5, pp. 506–512, 1995.
View at: Google Scholar
A. Valizadeh, A. J. Karayiannakis, I. El-Hariry, W. Kmiot, and M. Pignatelli, “Expression of E-cadherin-associated molecules (α-, β-, and γ-catenins and p120) in colorectal polyps,” American Journal of Pathology, vol. 150, no. 6, pp. 1977–1984, 1997.
View at: Google Scholar
B. Romagnolo, D. Berrebi, S. Saadi-Keddoucci et al., “Intestinal dysplasia and adenoma in transgenic mice after overexpression of an activated β-catenin,” Cancer Research, vol. 59, no. 16, pp. 3875–3879, 1999.
View at: Google Scholar
X. Ji, A. S. Woodard, D. L. Rimm, and E. R. Fearon, “Transcriptional defects underlie loss of E-cadherin expression in breast cancer,” Cell Growth and Differentiation, vol. 8, no. 7, pp. 773–778, 1997.
View at: Google Scholar
O. Aguilera, A. Muñoz, M. Esteller, and M. F. Fraga, “Epigenetic alterations of the Wnt/β-catenin pathway in human disease,” Endocrine, Metabolic and Immune Disorders—Drug Targets, vol. 7, no. 1, pp. 13–21, 2007.
View at: Google Scholar
M. Lacroix-Triki, F. C. Geyer, M. B. Lambros et al., “β-catenin/Wnt signalling pathway in fibromatosis, metaplastic carcinomas and phyllodes tumours of the breast,” Modern Pathology, vol. 23, no. 11, pp. 1438–1448, 2010.
View at: Google Scholar
M. Aoki, A. Hecht, U. Kruse, R. Kemler, and P. K. Vogt, “Nuclear endpoint of Wnt signaling: neoplastic transformation induced by transactivating lymphoid-enhancing factor 1,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 1, pp. 139–144, 1999.
View at: Publisher Site | Google Scholar
O. Huber, R. Korn, J. McLaughlin, M. Ohsugi, B. G. Herrmann, and R. Kemler, “Nuclear localization of β-catenin by interaction with transcription factor LEF-1,” Mechanisms of Development, vol. 59, no. 1, pp. 3–10, 1996.
View at: Publisher Site | Google Scholar
A. Bafico, A. Gazit, T. Pramila, P. W. Finch, A. Yaniv, and S. A. Aaronson, “Interaction of frizzled related protein (FRP) with Wnt ligands and the frizzled receptor suggests alternative mechanisms for FRP inhibition of Wnt signaling,” The Journal of Biological Chemistry, vol. 274, no. 23, pp. 16180–16187, 1999.
View at: Publisher Site | Google Scholar
B. Mann, M. Gelos, A. Siedow et al., “Target genes of β-catenin-T cell-factor/lymphoid-enhancer-factor signaling in human colorectal carcinomas,” Proceedings of the National Academy of Sciences of the United States of America, vol. 96, no. 4, pp. 1603–1608, 1999.
View at: Publisher Site | Google Scholar
R. K. Yantiss, M. Goodarzi, X. K. Zhou et al., “Clinical, pathologic, and molecular features of early-onset colorectal carcinoma,” The American Journal of Surgical Pathology, vol. 33, no. 4, pp. 572–582, 2009.
View at: Google Scholar
P. J. Kim, J. Plescia, H. Clevers, E. R. Fearon, and D. C. Altieri, “Survivin and molecular pathogenesis of colorectal cancer,” The Lancet, vol. 362, no. 9379, pp. 205–209, 2003.
View at: Publisher Site | Google Scholar
F. H. Brembeck, M. Rosário, and W. Birchmeier, “Balancing cell adhesion and Wnt signaling, the key role of β-catenin,” Current Opinion in Genetics and Development, vol. 16, no. 1, pp. 51–59, 2006.
View at: Publisher Site | Google Scholar
Y. Katoh and M. Katoh, “Hedgehog signaling, epithelial-to-mesenchymal transition and miRNA (review),” International Journal of Molecular Medicine, vol. 22, no. 3, pp. 271–275, 2008.
View at: Publisher Site | Google Scholar
S. Iwai, W. Katagiri, C. Kong, S. Amekawa, M. Nakazawa, and Y. Yura, “Mutations of the APC, beta-catenin, and axin 1 genes and cytoplasmic accumulation of beta-catenin in oral squamous cell carcinoma,” Journal of Cancer Research and Clinical Oncology, vol. 131, no. 12, pp. 773–782, 2005.
View at: Publisher Site | Google Scholar
Z.-G. Cai, X.-J. Shi, Y. Gao, M.-J. Wei, C.-Y. Wang, and G.-Y. Yu, “β-catenin expression pattern in primary oral squamous cell carcinoma,” Chinese Medical Journal, vol. 121, no. 19, pp. 1866–1870, 2008.
View at: Google Scholar
A. Gasparoni, A. Chaves, L. Fonzi, G. K. Johnson, G. B. Schneider, and C. A. Squier, “Subcellular localization of beta-catenin in malignant cell lines and squamous cell carcinomas of the oral cavity,” Journal of Oral Pathology and Medicine, vol. 31, no. 7, pp. 385–394, 2002.
View at: Publisher Site | Google Scholar
L. Barnes, J. W. Eveson, P. Reichart, and D. Sidranski, Pathology and Genetics of Head and Neck Tumours, World Health Classification of Tumours, IARC, Lyon, France, 2005.
G. Pannone, P. Bufo, A. Santoro et al., “WNT pathway in oral cancer: epigenetic inactivation of WNT-inhibitors,” Oncology Reports, vol. 24, no. 4, pp. 1035–1041, 2010.
View at: Publisher Site | Google Scholar
R. Franco, F. Boscia, V. Gigantino et al., “GPR30 is overexpressed in post-puberal testicular germ cell tumors,” Cancer Biology and Therapy, vol. 11, no. 6, pp. 609–613, 2011.
View at: Publisher Site | Google Scholar
M. Fedele, R. Franco, G. Salvatore et al., “PATZI gene has a critical role in the spermatogenesis and testicular tumours,” Journal of Pathology, vol. 215, no. 1, pp. 39–47, 2008.
View at: Publisher Site | Google Scholar
P. Papagerakis, G. Pannone, A. H. Shabana et al., “Aberrant beta-catenin and LEF1 expression may predict the clinical outcome for patients with oropharyngeal cancer,” International Journal of Immunopathology and Pharmacology, vol. 25, no. 1, pp. 135–146, 2012.
View at: Google Scholar
P. Duesberg, R. Stindl, and R. Hehlmann, “Origin of multidrug resistance in cells with and without multidrug resistance genes: chromosome reassortments catalyzed by aneuploidy,” Proceedings of the National Academy of Sciences of the United States of America, vol. 98, no. 20, pp. 11283–11288, 2001.
View at: Publisher Site | Google Scholar
P. McCullagh, “Regression models for ordinal data,” Journal of the Royal Statistical Society B, vol. 42, no. 2, pp. 109–142, 1980.
View at: Google Scholar
D. M. Parkin, S. L. Whelan, J. Ferlay, L. Raymond, and J. Young, Eds., Cancer Incidence in Five Continents, vol. 7 of IARC Scientific Publication no. 143, International Agency for Research on Cancer, Lyon, France, 1997.
S. Choi and J. N. Myers, “Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy,” Journal of Dental Research, vol. 87, no. 1, pp. 14–32, 2008.
View at: Publisher Site | Google Scholar
O. Aguilera, A. Muñoz, M. Esteller, and M. F. Fraga, “Epigenetic alterations of the Wnt/β-catenin pathway in human disease,” Endocrine, Metabolic and Immune Disorders—Drug Targets, vol. 7, no. 1, pp. 13–21, 2007.
View at: Google Scholar
H. Yamamoto, “Regulation of Wnt signaling pathway and its relationship with tumorigenesis,” Seikagaku, vol. 80, no. 12, pp. 1079–1093, 2008.
View at: Google Scholar
P. Bovolenta, P. Esteve, J. M. Ruiz, E. Cisneros, and J. Lopez-Rios, “Beyond Wnt inhibition: new functions of secreted Frizzled-related proteins in development and disease,” Journal of Cell Science, vol. 121, no. 6, pp. 737–746, 2008.
View at: Publisher Site | Google Scholar
G. Baretton, X. Li, C. Stoll, E. Fischer-Brandies, M. Schmidt, and U. Löhrs, “Prognostic significance of DNA ploidy in oral squamous cell carcinomas. A retrospective flow and image cytometric study with comparison of DNA ploidy in excisional biopsy specimens and resection specimens, primary tumors, and lymph node metastases,” Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and, vol. 79, no. 1, pp. 68–76, 1995.
View at: Google Scholar
A. Donadini, M. Maffei, A. Cavallero et al., “Oral cancer genesis and progression: DNA near-diploid aneuploidization and endoreduplication by high resolution flow cytometry,” Cellular Oncology, vol. 32, no. 5-6, pp. 373–383, 2010.
View at: Publisher Site | Google Scholar
P. Duesberg, A. Fabarius, and R. Hehlmann, “Aneuploidy, the primary cause of the multilateral genomic instability of neoplastic and preneoplastic cells,” IUBMB Life, vol. 56, no. 2, pp. 65–81, 2004.
View at: Publisher Site | Google Scholar
S. B. Baylin and J. E. Ohm, “Epigenetic gene silencing in cancer—a mechanism for early oncogenic pathway addiction?” Nature Reviews Cancer, vol. 6, no. 2, pp. 107–116, 2006.
View at: Publisher Site | Google Scholar
K.-T. Yeh, J.-G. Chang, T.-H. Lin et al., “Correlation between protein expression and epigenetic and mutation changes of Wnt pathway-related genes in oral cancer,” International Journal of Oncology, vol. 23, no. 4, pp. 1001–1007, 2003.
View at: Google Scholar
P. Polakis, “The many ways of Wnt in cancer,” Current Opinion in Genetics and Development, vol. 17, no. 1, pp. 45–51, 2007.
View at: Publisher Site | Google Scholar
J. Wilding, K. H. Vousden, W. P. Soutter, P. D. McCrea, R. Del Buono, and M. Pignatelli, “E-cadherin transfection down-regulates the epidermal growth factor receptor and reverses the invasive phenotype of human papilloma virus- transfected keratinocytes,” Cancer Research, vol. 56, no. 22, pp. 5285–5292, 1996.
View at: Google Scholar
Y. Sogabe, H. Suzuki, M. Toyota et al., “Epigenetic inactivation of SFRP genes in oral squamous cell carcinoma,” International Journal of Oncology, vol. 32, no. 6, pp. 1253–1261, 2008.
View at: Publisher Site | Google Scholar
G. D'Souza, A. R. Kreimer, R. Viscidi et al., “Case-control study of human papillomavirus and oropharyngeal cancer,” The New England Journal of Medicine, vol. 356, no. 19, pp. 1944–1956, 2007.
View at: Publisher Site | Google Scholar
M. L. Gillison, W. M. Koch, R. B. Capone et al., “Evidence for a causal association between human papillomavirus and a subset of head and neck cancers,” Journal of the National Cancer Institute, vol. 92, no. 9, pp. 709–720, 2000.
View at: Google Scholar
P. M. Weinberger, Z. Yu, B. G. Haffty et al., “Molecular classification identifies a subset of human papillomavirus- associated oropharyngeal cancers with favorable prognosis,” Journal of Clinical Oncology, vol. 24, no. 5, pp. 736–747, 2006.
View at: Publisher Site | Google Scholar
S. D. Hayward, J. Liu, and M. Fujimuro, “Notch and Wnt signaling: mimicry and manipulation by gamma herpesviruses,” Science's STKE, vol. 2006, no. 335, p. re4, 2006.
View at: Publisher Site | Google Scholar
M. Fujimuro and S. D. Hayward, “Manipulation of glycogen-synthase kinase-3 activity in KSHV-associated cancers,” Journal of Molecular Medicine, vol. 82, no. 4, pp. 223–231, 2004.
View at: Publisher Site | Google Scholar
J. A. Morrison, A. J. Klingelhutz, and N. Raab-Traub, “Epstein-Barr virus latent membrane protein 2A activates β-catenin signaling in epithelial cells,” Journal of Virology, vol. 77, no. 22, pp. 12276–12284, 2003.
View at: Publisher Site | Google Scholar
T. Rampias, E. Boutati, E. Pectasides et al., “Activation of Wnt signaling pathway by human papillomavirus E6 and E7 oncogenes in HPV16-positive oropharyngeal squamous carcinoma cells,” Molecular Cancer Research, vol. 8, no. 3, pp. 433–443, 2010.
View at: Publisher Site | Google Scholar
G. Pannone, A. Santoro, F. Carinci et al., “Double demonstration of oncogenic high risk human papilloma virus DNA and HPV-E7 protein in oral cancers,” International Journal of Immunopathology and Pharmacology, vol. 24, no. 2, supplement, pp. 95–101, 2011.
View at: Google Scholar
G. Pannone, V. Rodolico, A. Santoro et al., “Evaluation of a combined triple method to detect causative HPV in oral and oropharyngeal squamous cell carcinomas: P16 Immunohistochemistry, consensus PCR HPV-DNA, and in situ hybridization,” Infectious Agents and Cancer, vol. 7, article 4, 2012.
View at: Publisher Site | Google Scholar
G. Aquino, G. Pannone, A. Santoro et al., “pEGFR-Tyr 845 expression as prognostic factors in oral squamous cell carcinoma: a tissue-microarray study with clinic-pathological correlations,” Cancer Biology & Therapy, vol. 13, no. 11, pp. 1–11, 2012.
View at: Google Scholar
G. Pannone, A. Santoro, A. Feola et al., “The role of E-cadherin down-regulation in oral cancer: Cdh1 gene expression and epigenetic blockage,” Current Cancer Drug Targets, vol. 14, no. 2, 2014.
View at: Google Scholar
M. di Domenico, G. M. Pierantoni, A. Feola et al., “Prognostic significance of N-cadherin expression in oral squamous cell carcinoma,” Anticancer Research, vol. 31, no. 12, pp. 4211–4218, 2011.
View at: Google Scholar
R. Fodde and T. Brabletz, “Wnt/β-catenin signaling in cancer stemness and malignant behavior,” Current Opinion in Cell Biology, vol. 19, no. 2, pp. 150–158, 2007.
View at: Publisher Site | Google Scholar
M. Locke, M. Heywood, S. Fawell, and I. C. Mackenzie, “Retention of intrinsic stem cell hierarchies in carcinoma-derived cell lines,” Cancer Research, vol. 65, no. 19, pp. 8944–8950, 2005.
View at: Publisher Site | Google Scholar

Copyright

Copyright © 2014 Angela Santoro et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

PDF Download Citation

Download other formats

Order printed copies

Views

3024

Downloads

1712

Citations