BioMed Research International

BioMed Research International / 2015 / Article

Research Article | Open Access

Volume 2015 |Article ID 103052 | 9 pages | https://doi.org/10.1155/2015/103052

Development of Enhanced Primer Sets for Detection of Norovirus

Academic Editor: Elena Orlova
Received29 Aug 2014
Revised05 Nov 2014
Accepted27 Nov 2014
Published28 Jan 2015

Abstract

Norovirus (NV) is a major viral pathogen that causes nonbacterial acute gastroenteritis and outbreaks of food-borne disease. The genotype of NV most frequently responsible for NV outbreaks is GII.4, which accounts for 60–80% of cases. Moreover, original and new NV variant types have been continuously emerging, and their emergence is related to the recent global increase in NV infection. In this study, we developed advanced primer sets (NKI-F/R/F2, NKII-F/R/R2) for the detection of NV, including the variant types. The new primer sets were compared with conventional primer sets (GI-F1/R1/F2, SRI-1/2/3, GII-F1/R1/F2, and SRII-1/2/3) to evaluate their efficiency when using clinical and environmental samples. Using reverse transcription polymerase chain reaction (RT-PCR) and seminested PCR, NV GI and GII were detected in 91.7% (NKI-F/R/F2), 89.3% (NKII-F/R/R2), 54.2% (GI-F1/R1/F2), 52.5% (GII-F1/R1/F2), 25.0% (SRI-1/2/3), and 32.2% (SRII-1/2/3) of clinical and environmental specimens. Therefore, our primer sets perform better than conventional primer sets in the detection of emerged types of NV and could be used in the future for epidemiological diagnosis of infection with the virus.

1. Introduction

Norovirus (NV), belonging to family Caliciviridae, is a major cause of acute viral gastroenteritis [1]. Although symptoms, which typically appear between 12 and 48 h, are generally mild and self-limiting, they can be severe in immunocompromised groups such as infants and the elderly [2, 3]. Viral infection is primarily related to foodborne illness, but person-to-person contact and waterborne outbreaks are also important vehicles for transmission [47].

The NV genome is composed of approximately 7.7 kb of single stranded positive sense RNA (+ssRNA), which includes three open reading frames (ORFs): ORF1, ORF2, and ORF3 [8]. Six nonstructural proteins in a polyprotein are encoded by ORF1, including an RNA-dependent RNA polymerase (RdRp) [9]. ORF2 and ORF3 encode major structural capsid protein (VP1) and minor structural capsid protein (VP2), respectively [10]. VP1 consists of a shell domain (S) and two protruding (P) domains [11]. The P1 domain, a protruding flexible hinge region, is located between the S and P2 domains [12]. The P2 domain is a hypervariable region that binds to host cell [13]. The stability of VP1 is increased by VP2, which prevents its degradation [14].

NV is classified into six groups, genogroups I to VI (GI to GVI), based on the amino acid sequences of the RdRp and VP1 [5, 15, 16]. The genogroups GI, GII, and GIV are found in humans [5]. Outbreaks appear more frequently in GI, GII than GIV [1720]. In particular, GII.4 has emerged continuously every 2-3 years in an evolved form [21]. Consequently, it accounts for 87% of the NV outbreaks that occur globally [2224].

In the Republic of Korea, NV GII.4 Sydney type emerged between 2012 and 2013, during which time it accounted for 60.4% of NV GII.4 diagnoses [25]. Detection of the NV GII strain is difficult with existing RT-PCR primer sets (GII-F1/R1/F2, SRII-1/2/3) because of the continuous variation of the strain [26, 27]. In addition, GI-F1/R1 primer set does not always have sufficient specificity to detect NV because false-positive detection commonly occurs [28].

Therefore, the aim of this study was to develop primer sets for efficiently detecting NV GI and GII, including detection of newly emerged strains that could not previously be identified with conventional primer sets. Once new primer sets were developed, we evaluated their efficiency using an RT-PCR assay to test clinical and environmental specimens.

2. Materials and Methods

2.1. Collection of Clinical and Environmental Samples

Two sample types, clinical and environmental specimens, were used for detection of NV GI and GII. Eighty-six unknown samples were used for detection of NV GI. They included 22 clinical samples from Gyeonggi Institute of Health Environment (GIHE) that were originally obtained during 2012 and 2013 and 24 clinical and 40 environmental samples from Waterborne Virus Bank (WAVA) originally obtained from 2006 to 2013. To identify NV GII, we used 134 unknown samples that included 35 clinical samples from GIHE, originally collected during 2012 and 2013, and 32 clinical and 67 environmental samples from WAVA, collected from 2006 to 2013.

All stool specimens were collected from patients who suffered from diarrhea caused by acute gastroenteritis. Environmental specimens were collected from groundwater in the Republic of Korea during June and October 2013. All samples were stored at −80°C until use.

2.2. Ethical Clearance

All clinical samples were obtained during the medical treatment of patients with acute gastroenteritis. All patients provided written informed consent, which has been kept on file at the GIHE and WAVA. Human rights were not abused nor were ethical issues encountered during the study. All experimental work and collection of samples were supervised and approved by the Institutional Review Board (IRB) of Songeui Medical Campus, The Catholic University of Korea (approval number MC14SISI0039).

2.3. Primer Design

In order to design new primer sets, 37 sequences of NV GI (Table 1) and 52 sequences of NV GII (Table 2) were obtained from NCBI and imported into EditSeq and MegAlign in DNASTAR software (DNASTAR, USA).


Accession number
(GenBank)
GenotypeStrainAccession number
(GenBank)
Genotype Strain

EU085529GI.1P774.Delsjo2004/Gothenburg/SwedenKF039731GI.1CH4XO533/2009/USA
FJ515294GI.2Leuven/2003/BELKF039732GI.1CHA5A010/2009/USA
JN176918GI.2Roosendaal029/2006/NLKF039733GI.1CHA9A004_20110426/2011/USA
JN183159GI.9S48/2008/LillaKF039734GI.1CHA6A014/2009/USA
JN183161GI.7S24/2008/Lilla EdetKF039735GI.1CHA3A007/2008/USA
JN603244GI.3S29/2008/Lilla Edet/SwedenKF039736GI.1CHA7A011/2010/USA
JN603245GI.4S50/2008/Lilla Edet/SwedenKF039737GI.1CHA6A003_20091104/2009/USA
JQ388274GI.6Kingston/ACT160D/2010/AUKF306212GI.2Jingzhou/2013401/CHN
JQ743331GI.42000KF429761GI.18MoIIIL/1972/USA
JQ743332GI.21999KF429765GI.18W/1968/USA
JQ911594GI10360/2010/VNMKF429770GI.18McIII/1973/USA
JX023285GI.18FIIa/1968/USAKF429773GI.18CKIIIc/1974/USA
KC998959GI.6TCH-099/USA/2003KF429774GI.18UIIIf/1973/USA
KF039725GI.1CHA7A009/2010/USAKF429783GI.18K/1979/USA
KF039726GI.1/CHA6A003_20091031/2009/USAKF429789GI.18MC/1978/USA
KF039727GI.1CHA2A014/2008/USAKF586507GI.9CAIQ12110628
KF039728GI.1CHA2A014/2008/USAL07418
KF039729GI.1CHA6A007/2010/USAM87661
KF039730GI.1CHA9A004_20110419/2011/USA


Accession number
(GenBank)
GenotypeStrainAccession number
(GenBank)
Genotype Strain

AB447433GII.4Aormori/2006/JPJQ320072GII.2NF2002/USA/2002
AB541319GII.4Osaka/2007/JPJX445152GII.4AlbertaE131/2004/CA
AB541321GII.4Osaka2/2007/JPJX445153GII.4AlbertaEI142/2006/CA
AB541362GII.4Toyama5/2008/JPJX445157GII.4AlbertaEI513/2006/CA
AB543808GII.4FUMI/2010/JPJX445159GII.4AlbertaEI009/2008/CA
AB662873GII-2OC09104/2009/JPJX445161GII.4AlbertaEI210/2008/CA
AY485642GII.4Langen 1061/2002/GERJX445168GII.4AlbertaEI388/2008/CA
AY502023GII.4Farmington Hills/2002/USAJX459900GII.4NSW882J/2011/AU
DQ658413GII.4MD-2004/2004USAJN899245GII.21Salisbury150/2011/USA
DQ078814GII.4Hunter504D/2004/AUJX459907GII.4NSW3309/2012/AU
EF202588GII.4Toronto SK/2005/CANJX459908GII.4NSW0514/2012/AU
EU310927GII.4TCH186 2002 USJX846924GII.3HK71/1978/CHN
EF684915GII.4Shellharbour NSW696T/2006/AUSJX846925GII.2KL109/1978/MYS
FJ537135GII.4CHDC2094/1974/USJX846926GII.7CHDC3936/1988/USA
GQ645366GII.4NSW3639/2008/AUSJX989075GII.6GZ2010-L96/Guangzhou/CHN 2011
GQ845368GII.4NSW505G 2007 AUSKC175323GII.4Hong kong CUHK3630/2012/CHN
GQ845369GII.4Armidale NSW3901/2008/AUKC464499GII.12CGMH41/2010/TW
GU017907GII.148594/Maizuru/2008/ JPNKC464505GII.2CGMH47/2011/TW
GU134965GII.71738/2009/USAKC576910GII.6S9c/1976/SEN
GU445325GII.4New Orleans1805/2009/USAKC597138GII.2CHDC2596/1975/USA
GU969058GII.138679/Maizuru/2008 JPNKC597139GII.17C142/1978/GUF
GU980585GII.3CBNU1/2006/KORKC597140GII.3NIHIC8.1/2011/USA
HQ664990GII.12HS206/2010/USAKF306213GII.3Jingzhou/2013402/CHN
JN400623GII.4CGMH25/2010/TWKF429764GII.121K1/1972/USA
JN595867GII.4Ascension208/2010KF429769GII.2SnowMountRS/1975/USA
JN797508GII.1HawaiiTD/1974/USAX86557GII.4Lordsdale virus

We designed 3 candidates for the NV GI primer set and 5 candidates for the NV GII primer set in the conserved regions of ORF 1 and ORF 2. Among them, NKI and NKII (Table 3) which have outstanding efficiency were selected. Inner primers were designed to detect NV from water samples because NV generally presents with a low titer in water [29]. They were constructed based on conserved sites from primer sets NKI-F and NKII-R. We named the inner primers NKI-F2 and NKII-R2 and used them for nested PCR.

(a) GI

NKI primer set
PrimerNKI-F (forward)
GTAAATGATGATGGCGTCTAA

M87661 (GI).....................0
KF039732 (GI.1).....................0
KF306212 (GI.2).....................0
JN603244 (GI.3).....................0
JN603245 (GI.4).....................0
JQ388274 (GI.6).....................0
JN183161 (GI.7).....................0
KF586507 (GI.9).....................0

PrimerNKI-R (reverse)
ACCCADCCATTRTACATYTG

M87661 (GI)....................0
KF039732 (GI.1)....................0
KF306212 (GI.2)....................0
JN603244 (GI.3).....G..............1
JN603245 (GI.4)....................0
JQ388274 (GI.6)....................0
JN183161 (GI.7)....................0
KF586507 (GI.9)....................0

(b) GII

NKII primer set
PrimerNKII-F (forward)
CTYAGGCARATGTACTGGACY

X86557 (GII).....................0
JN797508 (GII.1).....A........T......2
KF429769 (GII.2).....................0
KF306213 (GII.3).....A........T......2
JX459907 (GII.4).....................0
KC464499 (GII.12).....A........T......2
KC597139 (GII.17).....................0
JN899245 (GII.21).....A...............1

PrimerNKII-R (reverse)
TCGACGCCATCTTCATTCAC

X86557 (GII)....................0
JN797508 (GII.1)....................0
KF429769 (GII.2)....................0
KF306213 (GII.3)....................0
JX459907 (GII.4)....................0
KC464499 (GII.12)....................0
KC597139 (GII.17)....................0
JN899245 (GII.21)....................0

2.4. Viral RNA Extraction

Viral RNA was extracted from clinical and environmental specimens with the QIAamp viral RNA extraction kit (Qiagen, Germany) according to the manufacturer’s instructions. Each viral RNA sample was eluted with 60 L of elution buffer and stored at −80°C until use in the RT-PCR assay.

2.5. RT-PCR and Seminested PCR

Extracted RNA was amplified by both RT-PCR and seminested PCR in S1000 Thermal Cycler (BIO-RAD, Singapore). In RT-PCR, extracted RNA was reverse-transcribed and amplified using the QIAGEN OneStep RT-PCR Kit (Qiagen, Germany) according to the manufacturer’s protocol. The total reaction mixture volume of 25 L contained the following: 5× QIAGEN OneStep RT-PCR buffer (5 L), 20 pmol primers (1 L each) (NKI-F/R, NKII-F/R, SRI-1/2, SRII-1/2, GI-F1/R1, and GII-F1/R1), 10 mM dNTP mix (1 L), enzyme mix (reverse transcriptase and Taq polymerase, 1 L), extracted viral RNA template (3 L), and RNase-free water (13 L) (Welgene, Republic of Korea). RT-PCR conditions were as follows: reverse transcription at 50°C for 30 min, initial PCR activation at 95°C for 15 min, 39 cycles of denaturation at 94°C for 30 s, annealing at each optimal annealing temperature (Tables 4 and 5) for 30 s, extension at 72°C for 1 min, and a final extension at 72°C for 10 min.


PrimersSequence (5′-3′)aLocationbRegionAnnealing temperature (°C)PolarityReference

NKI-FGTA AAT GAT GAT GGC GTC TAA5354–5373Capsid51+This study
NKI-RACC CAD CCA TTR TAC ATY TG5649–5668
NKI-F2GAT GGC GTC TAA GGA CGC5363–5380+

GI-F1CTG CCC GAA TTY GTA AAT GAT GAT5342–5365Capsid55+ [26]
GI-R1CCA ACC CAR CCA TTR TAC ATY TG5649–5671
GI-F2ATG ATG ATG GCG TCT AAG GAC GC5358–5380+

SRI-1CCA ACC CAR CCA TTR TAC AT5652–5671Capsid50 [27]
SRI-2AAA TGA TGA TGG CGT CTA5356–5373+
SRI-3AAA AYR TCA CCG GGK GTA T5578–5596

The means of alphabet sequence are the following: Y = C, T; R = A, G; K = G, T; D = A, G, T.
bLocation is based on accession number M87661 (Norwalk virus).

PrimersSequence (5′-3′)aLocationb RegionAnnealing temperature (°C)PolarityReference

NKII-F CTY AGG CAR ATG TAC TGG ACY4805–4825RdRp55+This study
NKII-RTCG ACG CCA TCT TCA TTC AC5081–5100
NKII-R2GGA GCC AGA TTG CGA TCG C5060–5078

GII-F1GGG AGG GCG ATC GCA ATC T5049–5067Capsid55+ [26]
GII-R1CCR CCI GCA TRI CCR TTR TAC AT5367–5389
GII-F2TTG TGA ATG AAG ATG GCG TCG ART5079–5102+

SRII-1CGC CAT CTT CAT TCA CAA A5078–5096RdRp50 [27]
SRII-2TWC TCY TTY TAT GGT GAT GAT GA4583–4605+
SRII-3TTW CCA AAC CAA CCW GCT G4767–4785

The means of alphabet sequence are the following: Y = C, T; R = A, G; I = inosine; W = A, T.
bLocation is based on accession number X86557 (Lordsdale virus).

For seminested PCR, the RT-PCR product (3 L), 20 pmol primers (1 L each) (NKI-F2/R, NKII-F/R2, SRI-2/3, SRII-2/3, GI-F2/R1, and GII-F2/R1), and RNase-free water (15 L) were added to a Maxime PCR PreMix Kit (-StarTaq) (iNtRON Biotechnology, Republic of Korea). PCR conditions were as follows: initial denaturation at 94°C for 2 min, 20 cycles of denaturation at 94°C for 20 s, annealing at each optimal annealing temperature (Tables 4 and 5) for 10 s, extension at 72°C for 20 s, and a final extension at 72°C for 5 min.

2.6. Sequence Analysis of PCR Products

The products of RT-PCR and seminested PCR were analyzed using 2% agarose gel electrophoresis in TAE buffer with DNA SafeStain solution (Lamda Biotech, USA) and were purified in agarose gel with a HiYield Gel/PCR DNA Fragments Extraction Kit (RBC, Taiwan). For sequencing, PCR products were sent to Cosmo Genetech (Republic of Korea), and returned sequences were analyzed using the basic local alignment search tool (BLAST) in NCBI.

2.7. Statistical Analysis

An efficiency test of both GI primer sets (GI-F1/R1/F2, SRI-1/2/3, and NKI-F/R/F2) and GII primer sets (GII-F1/R1/F2, SRII-1/2/3, and NKII-F/R/R2) was statistically analyzed using SPSS 20.0 [30].

2.8. Nucleotide Sequence Registration

The NV GI and NV GII sequences that were submitted to GenBank in NCBI (http://www.ncbi.nlm.nih.gov/) were isolated from stool and groundwater samples.

3. Results

3.1. Selection of Primer Sets

Collected NV sequences (37 from NV GI, 52 from NV GII) were aligned using EditSeq and MegAlign in DNASTAR software. Results showed that conserved sequences were selected in ORF1 and ORF2.

From the 3 and 5 respective candidate NV GI and NV GII primer sets that were evaluated for efficiency using clinical samples, the most efficient primer sets were selected and used in this study (Table 3).

3.2. Detection of NV GI and GII

To evaluate the efficiency of the new primer sets (NKI-F/R/F2, NKII-F/R/R2) designed for this study, we used RT-PCR and compared them to conventional primer sets for NV GI (GI-F1/R1/F2, SRI-1/2/3) and GII (GII-F1/R1/F2, SRII-1/2/3). The ORF1 region was amplified by NKII-F/R/R2 and SRII-1/2/3, while the ORF2 region was amplified by NKI-F/R/F2, SRI-1/2/3, GI-F1/R1/F2, and GII-F1/R1/F2 (Figure 1).

For NV GI, 84 samples were confirmed with GI-F1/R1/F2, SRI-1/2/3, and NKI-F/R/F2 detecting 13, 6, and 22 samples, respectively. For NV GII, 134 samples were identified using GII-F1/R1/F2, SRII-1/2/3, and NKII-F/R/R2 to detect 31, 19, and 53 samples, respectively.

3.3. Comparison of Primer Sets

In total, 83 positive samples were identified, including 50 clinical (18 NV GI, 32 NV GII) and 33 environmental (6 NV GI, 27 NV GII) specimens. The most sensitive primer set for NV GI was NKI-F/R/F2, which detected 22/24 positive samples (91.7%). In comparison, the other primers detected 13/24 (54.2%, GI-F1/R1/F2) and 6/24 (25.0%, SRI-1/2/3) samples containing NV GI.

In detecting NV GII, the NKII primer set showed a superior diagnostic yield compared to the other sets. NKIIF/R/R2 identified 53/59 (89.3%) positive NV GII samples, whereas GII-F1/R1/F2 and SRII-1/2/3 identified 31/59 (52.5%) and 19/59 (32.2%), respectively. Sensitivity using each primer set is shown in Table 6 (NV GI) and Table 7 (NV GII). SRI-1/2/3 and SRII-1/2/3 were unsuitable for use with environmental samples because positive samples were not detected.


Positive specimensNKI F/R/F2GI F1/R1/F2SRI 1/2/3

GI.333
GI.4624
GI.6541
GI.811
GI.151
GI11
Clinical samples
( = 18)
17 (94.4%)*10 (58.8%)6 (33.3%)

GI.343
GI.61
Environmental samples ( = 6)5 (83.3%)3 (50.0%)0 (0%)

Total ( = 24)22 (91.7%)13 (54.2%)6 (25.0%)

All values < 0.05 are by -test except for environmental samples (GI F1/R1/F2 and NKI F/R/F2).
Environmental samples were not detected by SRI 1/2/3 primer.
*Percentage is NV detection/NV positive ratio.

Positive specimensNKII F/R/R2GII F1/R1/F2SRII 1/2/3

GII.2211
GII.311
GII.4181112
GII.621
GII.131
GII.1611
GII.17424
GII.211
GII111
Clinical samples
( = 32)
30 (93.8%)*18 (56.3%)19 (59.4%)

GII.42211
GII12
Environmental samples ( = 27)23 (85.7%)13 (48.1%)0 (0%)

Total ( = 59)53 (89.3%)31 (52.5%)19 (32.2%)

All values < 0.05 are by -test.
Environmental samples were not detected by SRII 1/2/3 primer set.
*Percentage is NV detection/NV positive ratio.
3.4. Sequence Analysis

Results of BLAST sequence analysis indicated that some of the PCR products were amplified using several primers (GI-F1/R1/F2, GII-F1/R1/F2, and SRI-1/2/3) which were shown as false positives of NV, whereas NKI-F/R/F2, NKII-F/R/R2, and SRII-1/2/3 did not detect false positives for NV. However, NKI-F/R/F2 and SRI-1/2/3 did detect NV GII in some samples. Where NV GII was detected, it had similar sequences, which were as follows: AB290150 (NKI-F/R/F2), FJ383875 (NKI-F/R/F2, SRI-1/2/3), KF289337 (SRI-1/2/3), and KF509946 (NKI-F/R/F2, SRI-1/2/3).

Genotypes of NV GI.3, GI.4, GI.6, GI.8, and GI.15 and NV GII.2, GII.3, GII.4, GII.6, GII.13, GII.16, GII.17, and GII.21 were identified using GI and GII primer sets, respectively (Tables 6 and 7). Using all primer sets, 17 samples containing the NV GII.4 variant were identified. NKII-F/R/R2, SRII-1/2/3, and GII-F1M/R1M/F3M detected NV GII.4 variant type in 16, 12, and 10 samples, respectively.

From positive samples, amplified sequences obtained using NKIF/R/F2 and NKII-F/R/R2 were registered in NCBI. The deposited accession numbers were as follows: KJ742428, KJ742429, KJ742430, KJ742431, KJ742432, KJ742433, KJ742434, KJ742435, KJ742436, KJ742437, KJ742438, KJ742439, KJ742440, KM017944, KM017945, KM017946, KM017947, KM017948, KM017949, KM017950, KM017951, KM017952, KM017953, KM017954, KM017955, KM017956, KM017957, KM017958, and KM017959.

4. Discussion

In the USA, estimated 570–800 people die annually from outcomes associated with NV. Outbreaks of the virus occur regularly, and new variant strains are identified worldwide every 2 to 3 years [3, 21, 31, 32]. Methods for detection of NV include RT-PCR, the enzyme-linked immunosorbent assay (ELISA), and transmission electron microscopy (TEM) [33, 34]. In previous studies, virus concentrations up to 102 virus-copies/mL were detected using RT-PCR compared to 105 virus-copies/mL with other methods [33]. The widespread use of RT-PCR for NV detection can be attributed to its superior sensitivity compared to other methods [35, 36]. For example, it is the recommended method for detection of NV in contaminated water, in which NV commonly exists at 102–3.51 copies/mL [29]. However, in order to minimize outbreaks and prevent potential deaths, improved primer sets are required to accurately detect original and variant strains of NV.

It is possible that the primer sets used for detection of NV are different in each laboratory because a standard method for detection has not yet been established [37]. In previously published work, the primer sets GI-F1/R1/F2 and GII-F1/R1/F2, SRI-1/2/3 and SRII-1/2/3 have typically been used to detect NV [38, 39]. Indeed, GI-F1/R1/F2 and GII-F1/R1/F2 are recommended for detection of NV by the Centers for Disease Control and Prevention’s (CDC) of Republic of Korea (http://www.cdc.go.kr/CDC/contents/CdcKrContentView.jsp?cid=18302&menuIds=HOME001-MNU1175MNU834-MNU0839). Lee et al. (2011) used SRI-1/2/3, SRII-1/2/3, GI-F1/R1/F2, and GII-F1/R1/F2 primer sets when testing water samples collected in 2008 near groundwater in Republic of Korea [40]. They found that 117 sites were contaminated with NV GI and GII, and the study indicated that NV could more efficiently be detected with GI-F1/R1/F2 (35 samples) and GII-F1/R1/F2 (55 samples) compared to SRI-1/2/3 (27 samples) and SRII-1/2/3 (41 samples) [40]. Similarly, in the present study, the performance of SRI-1/2/3 and SRII-1/2/3 in detection of NV was inferior to other primer sets. In particular, SRI-1/2/3 and SRII-1/2/3 entirely failed to detect NV in water. Conversely, the majority of positive NV samples were detected using NKI-F/R/F2 (91.7%) and NKII-F/R/R2 (89.3%). We postulate that because the sequences of NKI-F/R/F2 and NKII-F/R/R2 were collected from 1968 to 2013, their design contained more conserved sequences in comparison to the GI-F1/R1/F2, GII-F1/R1/F2, SRI, and SRII primer sets and this could explain their superior performance.

NV GII.4 is known to be the most prevalent strain of NV [41], and since 2012 a new variant of NV GII.4 has caused many cases of gastroenteritis [42]. In detecting NV GII.4, an RT-PCR assay using a GII-F1/R1/F2 primer set or another forward primer (Cog2F, F2 FB, GV21) with a GII-F1/R1/F2 reverse primer has typically been used [25, 4244]. However, these primer sets were designed before 2005 and are not suitable for detection of new NV mutant types that have continuously emerged since, such as the 2012 Sydney strain. Their unsuitability is probably explained by differences in sequence between the primers and the new variant types [45, 46].

In this study, NKII-F/R/R2, GII-F1/R1/F2, and SRII were used to detect the NV GII.4 variant. In total, 17 NV GII variant samples were confirmed using NKII-F/R/R2, SRII-1/2/3, and GII-F1/R1/F2. They detected 16, 12, and 10 NV GII samples, respectively. The GII-F1/R1/F2 primer set has been widely used for detection of NV GII.4 [4244, 47]. However, in previous research, the efficiency of this primer set for detecting NV GII.4 was relatively low [25, 41]. Therefore, GII-F1/R1/F2 may be an inappropriate method for detection of the NV GII.4 variant.

5. Conclusions

In our study, we showed that the NKI-F/R/F2 and NKII-F/R/R2 primer sets could be important for epidemiological diagnosis of NV in the laboratory because of their superior performance compared to other primer sets. Where contamination with NV was suspected, these primer sets could be applied to specimens taken from water sample with a low titer or clinical samples with a high titer. Additionally, our newly developed primer sets can be used to detect variant types of NV. Therefore, we recommend the use of NKI-F/R/F2 and NKII-F/R/R2 in future research.

Conflict of Interests

The authors declare that there is no conflict of interests regarding the publication of this paper.

Acknowledgments

This study was supported by the National Research Foundation of Korea (NRF-2012R1A2A2A01045078) and Korea Environmental Industry & Technology Institute (2013000550009).

References

  1. S. Maritschnik, E. E. Kanitz, E. Simons et al., “A food handler-associated, foodborne norovirus GII.4 Sydney 2012-outbreak following a wedding dinner, Austria, October 2012,” Food and Environmental Virology, vol. 5, no. 4, pp. 220–225, 2013. View at: Publisher Site | Google Scholar
  2. S. M. Griffin, N. E. Brinkman, E. J. Hedrick, E. R. Rhodes, and G. S. Fout, “Comparison of nucleic acid extraction and reverse transcription-qPCR approaches for detection of GI and GII noroviruses in drinking water,” Journal of Virological Methods, vol. 199, pp. 76–85, 2014. View at: Publisher Site | Google Scholar
  3. M. M. Patel, A. J. Hall, J. Vinjé, and U. D. Parashar, “Noroviruses: a comprehensive review,” Journal of Clinical Virology, vol. 44, no. 1, pp. 1–8, 2009. View at: Publisher Site | Google Scholar
  4. K. Mattison, “Norovirus as a foodborne disease hazard,” Advances in Food and Nutrition Research, vol. 62, pp. 1–39, 2011. View at: Publisher Site | Google Scholar
  5. D.-P. Zheng, T. Ando, R. L. Fankhauser, R. S. Beard, R. I. Glass, and S. S. Monroe, “Norovirus classification and proposed strain nomenclature,” Virology, vol. 346, no. 2, pp. 312–323, 2006. View at: Publisher Site | Google Scholar
  6. S. Svraka, E. Duizer, H. Vennema et al., “Etiological role of viruses in outbreaks of acute gastroenteritis in The Netherlands from 1994 through 2005,” Journal of Clinical Microbiology, vol. 45, no. 5, pp. 1389–1394, 2007. View at: Publisher Site | Google Scholar
  7. L. Barclay, G. W. Park, E. Vega et al., “Infection control for norovirus,” Clinical Microbiology and Infection, vol. 20, no. 8, pp. 731–740, 2014. View at: Publisher Site | Google Scholar
  8. K. Y. Green, T. Ando, M. S. Balayan et al., “Taxonomy of the caliciviruses,” The Journal of Infectious Diseases, vol. 181, supplement 2, pp. S322–S330, 2000. View at: Publisher Site | Google Scholar
  9. G. Belliot, S. V. Sosnovtsev, T. Mitra, C. Hammer, M. Garfield, and K. Y. Green, “In vitro proteolytic processing of the MD145 Norovirus ORF1 nonstructural polyprotein yields stable precursors and products similar to those detected in calicivirus-infected cells,” Journal of Virology, vol. 77, no. 20, pp. 10957–10974, 2003. View at: Publisher Site | Google Scholar
  10. M. E. Hardy and M. K. Estes, “Completion of the Norwalk virus genome sequence,” Virus Genes, vol. 12, no. 3, pp. 287–290, 1996. View at: Google Scholar
  11. E. F. Donaldson, L. C. Lindesmith, A. D. Lobue, and R. S. Baric, “Viral shape-shifting: norovirus evasion of the human immune system,” Nature Reviews Microbiology, vol. 8, no. 3, pp. 231–241, 2010. View at: Publisher Site | Google Scholar
  12. A. Bertolotti-Ciarlet, L. J. White, R. Chen, B. V. V. Prasad, and M. K. Estes, “Structural requirements for the assembly of Norwalk virus-like particles,” Journal of Virology, vol. 76, no. 8, pp. 4044–4055, 2002. View at: Publisher Site | Google Scholar
  13. B. V. Prasad, M. E. Hardy, T. Dokland, J. Bella, M. G. Rossmann, and M. K. Estes, “X-ray crystallographic structure of the Norwalk virus capsid,” Science, vol. 286, no. 5438, pp. 287–290, 1999. View at: Publisher Site | Google Scholar
  14. A. Bertolotti-Ciarlet, S. E. Crawford, A. M. Hutson, and M. K. Estes, “The 3′ end of norwalk virus mRNA contains determinants that regulate the expression and stability of the viral capsid protein vp1: a novel function for the vp2 protein,” Journal of Virology, vol. 77, no. 21, pp. 11603–11615, 2003. View at: Publisher Site | Google Scholar
  15. T. N. Hoa Tran, E. Trainor, T. Nakagomi, N. A. Cunliffe, and O. Nakagomi, “Molecular epidemiology of noroviruses associated with acute sporadic gastroenteritis in children: global distribution of genogroups, genotypes and GII.4 variants,” Journal of Clinical Virology, vol. 56, no. 3, pp. 185–193, 2013. View at: Publisher Site | Google Scholar
  16. K. Green, “Caliciviridae: the noroviruses,” in Field Virology, D. M. Knipe and P. M. Howley, Eds., pp. 582–608, Lippincott Williams & Wilkins, Philadelphia, Pa, USA, 6th edition, 2013. View at: Google Scholar
  17. S. Fukuda, Y. Sasaki, S. Takao, and M. Seno, “Recombinant norovirus implicated in gastroenteritis outbreaks in Hiroshima Prefecture, Japan,” Journal of Medical Virology, vol. 80, no. 5, pp. 921–928, 2008. View at: Publisher Site | Google Scholar
  18. F. C. Tseng, J. S. Leon, J. N. MacCormack, J.-M. Maillard, and C. L. Moe, “Molecular epidemiology of norovirus gastroenteritis outbreaks in North Carolina, United States: 1995–2000,” Journal of Medical Virology, vol. 79, no. 1, pp. 84–91, 2007. View at: Publisher Site | Google Scholar
  19. T.-H. Han, S.-C. Kim, S.-T. Kim, C.-H. Chung, and J.-Y. Chung, “Detection of norovirus genogroup IV, klassevirus, and pepper mild mottle virus in sewage samples in South Korea,” Archives of Virology, vol. 159, no. 3, pp. 457–463, 2014. View at: Publisher Site | Google Scholar
  20. Y. Yan, H.-H. Wang, L. Gao et al., “A one-step multiplex real-time RT-PCR assay for rapid and simultaneous detection of human norovirus genogroup I, II and IV,” Journal of Virological Methods, vol. 189, no. 2, pp. 277–282, 2013. View at: Publisher Site | Google Scholar
  21. J. J. Siebenga, H. Vennema, B. Renckens et al., “Epochal evolution of GGII.4 norovirus capsid proteins from 1995 to 2006,” Journal of Virology, vol. 81, no. 18, pp. 9932–9941, 2007. View at: Publisher Site | Google Scholar
  22. A. Polkowska, M. Ronnqvist, and O. Lepisto, “Outbreak of gastroenteritis caused by norovirus GII.4 Sydney variant after a wedding reception at a resort/activity centre, Finland, August 2012,” Epidemiology and Infection, vol. 142, no. 9, pp. 1877–1883, 2012. View at: Publisher Site | Google Scholar
  23. S. M. Ahmed, B. A. Lopman, and K. Levy, “A systematic review and meta-analysis of the global seasonality of norovirus,” PLoS ONE, vol. 8, no. 10, Article ID e75922, 2013. View at: Publisher Site | Google Scholar
  24. J. A. Marshall and L. D. Bruggink, “The dynamics of norovirus outbreak epidemics: recent insights,” International Journal of Environmental Research and Public Health, vol. 8, no. 4, pp. 1141–1149, 2011. View at: Publisher Site | Google Scholar
  25. H. S. Kim, J. Hyun, H.-S. Kim, J.-S. Kim, W. Song, and K. M. Lee, “Emergence of GII.4 Sydney norovirus in South Korea during the winter of 2012-2013,” Journal of Microbiology and Biotechnology, vol. 23, no. 11, pp. 1641–1643, 2013. View at: Publisher Site | Google Scholar
  26. S. H. Kim, D. S. Cheon, J. H. Kim et al., “Outbreaks of gastroenteritis that occurred during school excursions in Korea were associated with several waterborne strains of norovirus,” Journal of Clinical Microbiology, vol. 43, no. 9, pp. 4836–4839, 2005. View at: Publisher Site | Google Scholar
  27. D. Häfliger, M. Gilgen, J. Lüthy, and P. Hübner, “Seminested RT-PCR systems for small round structured viruses and detection of enteric viruses in seafood,” International Journal of Food Microbiology, vol. 37, no. 1, pp. 27–36, 1997. View at: Publisher Site | Google Scholar
  28. E. Wollants and M. van Ranst, “Detection of false positives with a commonly used Norovirus RT-PCR primer set,” Journal of Clinical Virology, vol. 56, no. 1, pp. 84–85, 2013. View at: Publisher Site | Google Scholar
  29. L. Kittigul, A. Panjangampatthana, K. Pombubpa et al., “Detection and genetic characterization of norovirus in environmental water samples in Thailand,” The Southeast Asian Journal of Tropical Medicine and Public Health, vol. 43, no. 2, pp. 323–332, 2012. View at: Google Scholar
  30. H. S. Lee and J. H. Lim, SPSS 20.0 Manual, Jiphyunjae, Seoul, Republic of Korea, 2013.
  31. A. J. Hall, B. A. Lopman, D. C. Payne et al., “Norovirus disease in the united states,” Emerging Infectious Diseases, vol. 19, no. 8, pp. 1198–1205, 2013. View at: Publisher Site | Google Scholar
  32. L. Barclay, G. W. Park, E. Vega et al., “Infection control for norovirus,” Clinical Microbiology and Infection, vol. 20, no. 8, pp. 731–740, 2014. View at: Publisher Site | Google Scholar
  33. H. F. Rabenau, M. Stürmer, S. Buxbaum, A. Walczok, W. Preiser, and H. W. Doerr, “Laboratory diagnosis of norovirus: which method is the best?” Intervirology, vol. 46, no. 4, pp. 232–238, 2003. View at: Publisher Site | Google Scholar
  34. J. Vinjé, “Advances in laboratory methods for detection and typing of norovirus,” Journal of Clinical Microbiology, 2014. View at: Publisher Site | Google Scholar
  35. E. de Bruin, E. Duizer, H. Vennema, and M. P. G. Koopmans, “Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR,” Journal of Virological Methods, vol. 137, no. 2, pp. 259–264, 2006. View at: Publisher Site | Google Scholar
  36. M. Swellam, M. S. Mahmoud, and A. A.-F. Ali, “Diagnosis of hepatitis C virus infection by enzyme-linked immunosorbent assay and reverse transcriptase-nested polymerase chain reaction: a comparative evaluation,” IUBMB Life, vol. 63, no. 6, pp. 430–434, 2011. View at: Publisher Site | Google Scholar
  37. E. Guévremont, J. Brassard, A. Houde, C. Simard, and Y.-L. Trottier, “Development of an extraction and concentration procedure and comparison of RT-PCR primer systems for the detection of hepatitis A virus and norovirus GII in green onions,” Journal of Virological Methods, vol. 134, no. 1-2, pp. 130–135, 2006. View at: Publisher Site | Google Scholar
  38. I. L. A. Boxman, J. J. H. C. Tilburg, N. A. J. M. Te Loeke et al., “Detection of noroviruses in shellfish in the Netherlands,” International Journal of Food Microbiology, vol. 108, no. 3, pp. 391–396, 2006. View at: Publisher Site | Google Scholar
  39. H. K. Joung, S. H. Han, S.-J. Park et al., “Nationwide surveillance for pathogenic microorganisms in groundwater near carcass burials constructed in South Korea in 2010,” International Journal of Environmental Research and Public Health, vol. 10, no. 12, pp. 7126–7143, 2013. View at: Publisher Site | Google Scholar
  40. S.-G. Lee, W.-H. Jheong, C.-I. Suh et al., “Nationwide groundwater surveillance of noroviruses in South Korea, 2008,” Applied and Environmental Microbiology, vol. 77, no. 4, pp. 1466–1474, 2011. View at: Publisher Site | Google Scholar
  41. J.-G. Fu, J. Ai, X. Qi, J. Zhang, F.-Y. Tang, and Y.-F. Zhu, “Emergence of two novel norovirus genotype II.4 variants associated with viral gastroenteritis in China,” Journal of Medical Virology, vol. 86, no. 7, pp. 1226–1234, 2014. View at: Publisher Site | Google Scholar
  42. H. Mai, M. Jin, X. Guo et al., “Clinical and epidemiologic characteristics of norovirus GII.4 sydney during winter 2012-13 in beijing, china following its global emergence,” PLoS ONE, vol. 8, no. 8, Article ID e71483, 2013. View at: Publisher Site | Google Scholar
  43. A. Thongprachum, W. Chan-it, P. Khamrin et al., “Molecular epidemiology of norovirus associated with gastroenteritis and emergence of norovirus GII.4 variant 2012 in Japanese pediatric patients,” Infection, Genetics and Evolution, vol. 23, pp. 65–73, 2014. View at: Publisher Site | Google Scholar
  44. J. Fonager, S. Barzinci, and T. K. Fischer, “Emergence of a new recombinant Sydney 2012 norovirus variant in Denmark, 26 December 2012 to 22 March 2013,” Eurosurveillance, vol. 18, no. 25, 2013. View at: Google Scholar
  45. J.-S. Eden, M. M. Tanaka, M. F. Boni, W. D. Rawlinson, and P. A. White, “Recombination within the pandemic norovirus GII.4 lineage,” Journal of Virology, vol. 87, no. 11, pp. 6270–6282, 2013. View at: Publisher Site | Google Scholar
  46. V. Martella, M. C. Medici, S. de Grazia et al., “Evidence for recombination between pandemic GII.4 norovirus strains New Orleans 2009 and Sydney 2012,” Journal of Clinical Microbiology, vol. 51, no. 11, pp. 3855–3857, 2013. View at: Publisher Site | Google Scholar
  47. M. C. W. Chan, T. F. Leung, A. K. Kwok, N. Lee, and P. K. S. Chan, “Characteristics of patients infected with norovirus GII.4 Sydney 2012, Hong Kong, China,” Emerging Infectious Diseases, vol. 20, no. 4, pp. 558–661, 2014. View at: Publisher Site | Google Scholar

Copyright © 2015 Byoung-Hwa Kong et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

2254 Views | 871 Downloads | 3 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19.