Table of Contents Author Guidelines Submit a Manuscript
RETRACTED

BioMed Research International has retracted this article. This article is one of a series of very similar articles on shRNA and cancer cell lines identified by Byrne and Labbé [2]; the intertextual distance between this article and another of the series [3] is lower than expected by chance. The following concerns were found:(i)The supposed nontargeting control shRNA sequence, 5 GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3, targets TPD52L2 (NM_199360). The same sequence was used as a nontargeting control in other articles identified by Byrne and Labbé. The authors say resequencing showed that the nontargeting sequence plasmid they bought is actually an empty vector.(ii)There is duplication between panels in Figure (a) (between the top left and top right panels and between the bottom left and center left panels), which the authors say was due to carelessness.(iii)The control panels of Figures (a) and (a) in this article are the same as in Figures (a) and (a), respectively, in the authors’ article on Linc-ITGB1 [4], which was not cited. The authors said knockdown of KIAA0125 and Linc-ITGB1 expression by RNAi was performed simultaneously, so they shared the same controls.

BioMed Research International
Volume 2015 (2015), Article ID 108458, 9 pages
http://dx.doi.org/10.1155/2015/108458
Research Article

Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer

Department of General Surgery, Xinhua Hospital Affiliated to School of Medicine, Shanghai Jiao Tong University, 1665 Kongjiang Road, Shanghai 200092, China

Received 29 May 2014; Revised 15 August 2014; Accepted 20 August 2014

Academic Editor: Aurelio Ariza

Copyright © 2015 Wenjie Lv et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to Cite this Article

Wenjie Lv, Lei Wang, Jianhua Lu, Jiasheng Mu, Yingbin Liu, and Ping Dong, “Long Noncoding RNA KIAA0125 Potentiates Cell Migration and Invasion in Gallbladder Cancer,” BioMed Research International, vol. 2015, Article ID 108458, 9 pages, 2015. doi:10.1155/2015/108458