N1303K (c.3909C>G) Mutation and Splicing: Implication of Its c.[744-33GATT(6); 869+11C>T] Complex Allele in CFTR Exon 7 Aberrant Splicing

Table 1

Primers used in amplification and sequencing of studied regions.

Use	Hybridization	Primers
(a) Insert preparation containing the WT exon 24	Intron 23/intron 24	5′ACTTGATGGTAAGTACATGG3′
		5′AGGTATGTTAGGGTACTCCA3′
(b) Insert preparation containing c.[744-33GATT(7);869+11C] or c.[744-33GATT(6);869+11C>T]	Intron 6/intron 7	5′CCAGATTGCATGCTTACTA3′
		5′AGTTACCAATCAGCCTTCA3′
(c) Directed mutagenesis to introduce the c.3909C>G mutation on the pTBNdeI plasmid containing the WT exon 24 insert	Exon 24	5′TCTGGAACATTTAGAAAAAAGTTGGATCCCT3′
		5′TTTTTTCTAAATGTTCCAGAAAAAATAAATACTTT3′
(d) Verifying the correct introduction of the inserts in pTBNdeI and the correct realization of the direct mutagenesis	Intron fibronectin 1/intron fibronectin 2	5′ACTTCAGATATTATGTCTAGG3′
		5′CCCCATGTGAGATATCTAG3′
(e) Sequencing cDNA of cultured cells	Exon globin 3/fibronectin 2	5′CAACTTCAAGCTCCTAAGCCACTGC3′
		5′AGGGTCACCAGGAAGTTGGTTAAATCA3′