Genetic Variability of Candida albicans Sap8 Propeptide in Isolates from Different Types of Infection

Table 1

Alleles structure of CAVIII microsatellite. The consensus sequence obtained from database sequence for SC5314 strain is indicated and contains 10 repetitive units.

CAVIII—consensus sequence: P1(25 bp)tgaaaaagttgtctcattagattttaccgttaccagaaaaccttttaatgctactgctcatggacaacatcatcaatccCAA(CAG)3(CAA)6ccagctcaaaaaagaggaactgtt; caaacaagtttgattaatgaaggtccatcatatgctgctaccatcactgttggttcaaacaaacaacaacaaactgttattgttgacacaggttc-P2(25 bp)
Allele (bp)
5	(263)	Data not analysed
6	(266)	Data not analysed
7	(269)	Data not analysed
8	(272)	(79 bp) --------------(CAA)8------------------(119 bp)
9	(275)	(79 bp) --------------(CAA)9------------------(119 bp)
10a	(278)	(79 bp) CAA(CAG)3(CAA)6------------------(119 bp)
10b	(278)	(79 bp) CAA(CAG)4(CAA)5------------------(119 bp)
11	(281)	Data not analysed
12a	(284)	(79 bp) CAA(CAG)3(CAA)8------------------(119 bp)
12b	(284)	(79 bp) CAA(CAG)2(CAA)5CAG(CAA)3----(119 bp)
13	(287)	(79 bp) CAA(CAG)3(CAA)9------------------(119 bp)
14	(290)	Data not analysed

P1 and P2 represent the forward and reverse primers, respectively.
Data not analysed indicates not sequenced alleles.