BioMed Research International

BioMed Research International / 2015 / Article

Research Article | Open Access

Volume 2015 |Article ID 209792 | https://doi.org/10.1155/2015/209792

Zhong-Yuan Li, Jing Lu, Dong-Hui Zhou, Jia Chen, Xing-Quan Zhu, "Sequence Variation in HSP40 Gene among 16 Toxoplasma gondii Isolates from Different Hosts and Geographical Locations", BioMed Research International, vol. 2015, Article ID 209792, 6 pages, 2015. https://doi.org/10.1155/2015/209792

Sequence Variation in HSP40 Gene among 16 Toxoplasma gondii Isolates from Different Hosts and Geographical Locations

Academic Editor: Somboon Tanasupawat
Received10 Jul 2015
Accepted19 Oct 2015
Published03 Nov 2015

Abstract

Toxoplasma gondii with worldwide distribution has received substantial medical and scientific attentions as it causes serious clinical and veterinary problems especially for pregnant women and immunocompromised patients. Heat shock protein 40 (HSP40) plays a variety of essential roles in the pathogenesis of this protozoan parasite. In order to detail the genetic diversity of HSP40 gene, 16 T. gondii strains from different hosts and geographical locations were used in this study. Our results showed that HSP40 sequence of the examined strains was between 6621 bp and 6644 bp in length, and their A+T content was from 48.54% to 48.80%. Furthermore, sequence analysis presented 195 nucleotide mutation positions (0.12%–1.14%) including 29 positions in CDS (0.02%–0.12%) compared with T. gondii ME49 strain (ToxoDB: TGME49_265310). Phylogenetic assay revealed that T. gondii strains representing three classical genotypes (Types I, II, and III) were completely separated into different clusters by maximum parsimony (MP) method, but Type II and ToxoDB#9 strains were grouped into the same cluster. These results suggested that HSP40 gene is not a suitable marker for T. gondii population genetic research, though three classical genotypes of T. gondii could be differentiated by restriction enzymes MscI and EarI existing in amplicon C.

1. Introduction

Toxoplasma gondii infects almost all the warm-blooded animals including about one-third population of humans [1, 2] and can cause serious clinical diseases, especially in pregnant women and immunocompromised individuals such as tumor sufferers and AIDS patients [3, 4]. T. gondii can also cause abortion and congenital toxoplasmosis in livestock, leading to considerable economic losses [5, 6].

Heat shock proteins (HSPs) involved in antigen presentation and cross-presentation play important roles in activation of immune-related cells such as macrophages, lymphocytes, and DCs [79]. As the important member of HSPs, HSP40 associated with DNA replication, protein folding, assembling and degradation, translocation across membranes, signal transduction, and endocytosis participates in the pathogenesis of apicomplexan parasites such as Plasmodium falciparum [10, 11]. Recent studies emphasized that different clonal types of T. gondii strains with diverse geographical distribution can cause different toxoplasmosis in animals and humans [12, 13]. In order to unveil the details of T. gondii genetic diversity, sequence variation of the type II HSP40TgSIS1 (ToxoDB: TGME49_265310, previously named TGME49_065310) [14] among T. gondii isolates from different hosts and geographical regions was examined in this study.

2. Materials and Methods

2.1. T. gondii Isolates and gDNA Preparation

Sixteen T. gondii isolates harvested from different hosts and geographical locations were used in the present study (Table 1). Genomic DNA was extracted as normal and stored at −20°C till used.


NumberIsolateHostGeographical locationGenotype

1CTGCatUnited StatesReference, Type III, ToxoDB#2
2TgCatBr64CatBrazilReference, ToxoDB#111
3GT1GoatUnited StatesReference, Type I, ToxoDB#10
4RHHumanFranceReference, Type I, ToxoDB#10
5TgPLHPigHenan, ChinaType I, ToxoDB#10
6TgToucanToucanCosta RicaReference, ToxoDB#52
7MASHumanFranceReference, ToxoDB#17
8TgCatBr5CatBrazilReference, ToxoDB#19
9PTGSheepUnited StatesReference, Type II, ToxoDB#1
10PRUHumanFranceType II, ToxoDB#1
11QHOSheepQinghai, ChinaType II, ToxoDB#1
12TgC7CatGuangzhou, ChinaToxoDB#9
13PYSPigPanyu, ChinaToxoDB#9
14GJSPigJingyuan, Gansu, ChinaToxoDB#9
15TgCgCa1CougarCanadaReference, ToxoDB#66
16TgWtdSc40DeerUSAType 12, ToxoDB#5

Based on the results of Zhou et al. [25, 26] and Su et al. [20].
2.2. PCR Amplification and Sequencing

Three fragments (A, B, and C) (Figure 1) were separated based on the HSP40 sequence of T. gondii ME49 isolate (ToxoDB: TGME49_265310), and the amplifications were performed by PCR using three pairs of specific primers, respectively (Table 2). Thermal cycling conditions were according to the following protocol: initial denaturation at 94°C for 10 min followed by 35 cycles composing of 94°C for 1 min, 54.7°C (amplicon A), 66.8°C (amplicon B) or 64.0°C (amplicon C) for 45 s respectively, and 72°C for 2 min, and the additional extension step was carried out at 72°C for 10 min. Negative control without gDNA was included in each amplification. PCR amplifications were confirmed by agarose gel electrophoresis as previously described [15]. All the PCR products were purified using spin columns (Promega, Madison, USA), ligated with pMD18-T vector (TaKaRa, Dalian, China), and transformed into E. coli DH5α competent cells (Promega) according to the manufacturers’ instructions. The positive colonies confirmed by PCR were sequenced by Shanghai Sangon Biological Engineering Biotechnology Company. All the experiments were run in triplicate.


PrimerSequence (5′-3′)

F40AATGGGGAAGGTAATCACATT
R40ACGACTGGAACTATCGATTTC
F40BTGTGGGGCGAGAGCCAGAGG
R40BTGCAGAGGTGCCTTGCGTTT
F40CCCCTGCATCGCGTGAGCTTC
R40CAACGAGTGGAAAGCCCCCGT

Amplicons A, B, and C were amplified from different T. gondii strains by PCR using F40A/R40A, F40B/R40B, and F40C/R40C, respectively.
2.3. Sequence Analysis and Phylogenetic Reconstruction

The sequences of all the examined T. gondii strains were amplified step by step and sequenced. Alignment analysis based on the obtained sequences including the reference one (ToxoDB: TGME49_265310) was carried out with Clustal X 1.83 [16], and the number of sequence variation compared with ME49 strain was calculated as previously described [17]. Phylogenetic reconstructions were performed by maximum parsimony (MP) method using 4.0b10 [18], and 100 random addition searches using tree-bisection reconnection (TBR) were carried out for each MP assay. Bootstrap probability (BP) was calculated from 1,000 bootstrap replicates with 10 random additions per replicate in PAUP.

2.4. Characterization of T. gondii Isolates by PCR-RFLP

To evaluate whether HSP40 gene was suitable for genotyping of T. gondii isolates, PCR-RFLP method was also used in this study as previously described [19, 20]. All the PCR products of amplicon C were digested with two restriction enzymes MscI and EarI by incubating at 37°C for 4 h according to the manufacturer’s instructions (NEB, Beijing, China). And the restriction fragments were separated by electrophoresis as previously described [21].

3. Results and Discussion

Our results showed that HSP40 gene of all the examined strains was between 6621 bp and 6644 bp in length spliced by amplicons A (2430 bp), B (2107–2130 bp), and C (2252 bp), and their A+T contents varied from 48.54% to 48.80% (Figure 1, Table 3). The alignment of all the 17 sequences revealed nucleotide mutations at 195 positions (0.12%–1.14%) in HSP40 genomic locations and 29 positions in CDS (0.02%–0.12%) in comparison with T. gondii ME49 strain (ToxoDB: TGME49_265310), which was lower than our previous reports of GRA5 [21], ROP38 [22], ROP47 [23], eIF4A [15], and other genes of T. gondii, such as GRA6 [24]. Moreover, 141 transitions ( and ) and 54 transversions (, , , and ) ( = transition/transversion = 2.6) were also identified, and the distance of evolutionary divergence was 0.1%–1.0% among the examined T. gondii strains (Table 3).


ItemDNAcDNACDSNumber of intron
1234567891011

Length (bp)6621–664416201011471595320278501629–651533-534547287367473
A+T (%)48.54–48.8045.12–45.5645.20–45.7044.80–45.6548.40–48.9145.62–46.5645.68–46.4051.70–52.1053.90–54.9948.78–50.2851.74–52.4754.70–55.7545.78–46.3247.36–47.78
Transition 14136267155381412109616
Transversion5453260048109514
2.67.28.63.52.521.71.21.11.864
Distance (%)0.1–1.00.1–0.70–1.10–1.10–1.40–0.90–1.10–1.80–1.90–2.10–1.80–2.10–1.10.2–1.5

= transition/transversion; — means no data here.

Nucleotide polymorphisms analysis revealed two polymorphic restriction sites MscI and EarI in the sequence of amplicon C (2252 bp in length), which can differentiate three classical genotypes of T. gondii (Types I, II, and III) (Figure 2) [19, 20, 25, 26]. In brief, the PCR products of TgToucan, MAS, TgCatBr5, and T. gondii Type I strains (GT1, RH, and TgPLH) were digested into four segments (81, 165, 811, and 1195 bp); Type II strains (PTG, PRU, and QHO), ToxoDB#9 (TgC7, PYS, and GJS), TgCgCa1, and TgWtdSc40 were composed of three parts (81, 811, and 1360 bp); and the PCR products of Type III (CTG) and TgCatBr64 were cut into five sections (81, 165, 381, 811, and 814 bp). The results suggested that all the examined T. gondii strains could not be completely separated into their own groups by PCR-RFLP especially for ToxoDB#9 strains.

Phylogenetic reconstruction was constructed based on HSP40 sequences of the 17 T. gondii strains including T. gondii ME49 isolates (ToxoDB: TGME49_265310) (Figure 3) [18]. Our results showed that T. gondii strains belonging to Type II (PRU, QHO, ME49, and PTG), Type 12 (TgWtdSc40), or ToxoDB#9 (PYS, TgC7 and GJS) were grouped into the same cluster, whereas TgToucan (ToxoDB#52) was gathered into the cluster of Type I (RH, GT1, and TgPLH), suggesting that the examined T. gondii strains could not be completely separated by MP method though three classical genotypes of T. gondii (Types I, II, and III) were clustered into different groups.

4. Conclusion

Our data suggested that HSP40 gene is not a suitable marker for T. gondii population genetic study, though three classical genotypes of T. gondii (Types I, II, and III) could be differentiated by polymorphic restriction endonuclease sites MscI and EarI existing in amplicon C.

Conflict of Interests

All the authors declare no conflict of interests.

Authors’ Contribution

Zhong-Yuan Li and Jing Lu contributed equally to this work.

Acknowledgments

This project support was provided, in part, by the National Natural Science Foundation of China (Grant no. 31172316) and the Science Fund for Creative Research Groups of Gansu Province (Grant no. 1210RJIA006).

References

  1. J. G. Montoya and O. Liesenfeld, “Toxoplasmosis,” The Lancet, vol. 363, no. 9425, pp. 1965–1976, 2004. View at: Publisher Site | Google Scholar
  2. D. Schlüter, W. Däubener, G. Schares, U. Groß, U. Pleyer, and C. Lüder, “Animals are key to human toxoplasmosis,” International Journal of Medical Microbiology, vol. 304, no. 7, pp. 917–929, 2014. View at: Publisher Site | Google Scholar
  3. K. Kim and L. M. Weiss, “Toxoplasma: the next 100 years,” Microbes and Infection, vol. 10, no. 9, pp. 978–984, 2008. View at: Publisher Site | Google Scholar
  4. L. M. Weiss and J. P. Dubey, “Toxoplasmosis: a history of clinical observations,” International Journal for Parasitology, vol. 39, no. 8, pp. 895–901, 2009. View at: Publisher Site | Google Scholar
  5. J. P. Dubey, Toxoplasmosis of Animals and Humans, CRC Press, Boca Raton, Fla, USA, 2nd edition, 2010.
  6. P. Zhou, Z. Chen, H.-L. Li et al., “Toxoplasma gondii infection in humans in China,” Parasites & Vectors, vol. 4, article 165, 2011. View at: Publisher Site | Google Scholar
  7. Z. Li, A. Menoret, and P. Srivastava, “Roles of heat-shock proteins in antigen presentation and cross-presentation,” Current Opinion in Immunology, vol. 14, no. 1, pp. 45–51, 2002. View at: Publisher Site | Google Scholar
  8. G. Kaul and H. Thippeswamy, “Role of heat shock proteins in diseases and their therapeutic potential,” Indian Journal of Microbiology, vol. 51, no. 2, pp. 124–131, 2011. View at: Publisher Site | Google Scholar
  9. T. J. Borges, L. Wieten, M. J. C. van Herwijnen et al., “The anti-inflammatory mechanisms of Hsp70,” Frontiers in Immunology, vol. 3, article 95, 2012. View at: Publisher Site | Google Scholar
  10. P. Acharya, S. Chaubey, M. Grover, and U. Tatu, “An exported heat shock protein 40 associates with pathogenesis-related knobs in Plasmodium falciparum infected erythrocytes,” PLoS ONE, vol. 7, no. 9, Article ID e44605, 2012. View at: Publisher Site | Google Scholar
  11. S. Külzer, S. Charnaud, T. Dagan et al., “Plasmodium falciparum-encoded exported hsp70/hsp40 chaperone/co-chaperone complexes within the host erythrocyte,” Cellular Microbiology, vol. 14, no. 11, pp. 1784–1795, 2012. View at: Publisher Site | Google Scholar
  12. L. D. Sibley and J. W. Ajioka, “Population structure of Toxoplasma gondii: clonal expansion driven by infrequent recombination and selective sweeps,” Annual Review of Microbiology, vol. 62, pp. 329–351, 2008. View at: Publisher Site | Google Scholar
  13. F. Robert-Gangneux and M.-L. Dardé, “Epidemiology of and diagnostic strategies for toxoplasmosis,” Clinical Microbiology Reviews, vol. 25, no. 2, pp. 264–296, 2012. View at: Publisher Site | Google Scholar
  14. M. J. Figueras, O. A. Martin, P. C. Echeverria et al., “Toxoplasma gondii Sis1-like J-domain protein is a cytosolic chaperone associated to HSP90/HSP70 complex,” International Journal of Biological Macromolecules, vol. 50, no. 3, pp. 725–733, 2012. View at: Publisher Site | Google Scholar
  15. J. Chen, S.-F. Fang, D.-H. Zhou, Z.-Y. Li, G.-H. Liu, and X.-Q. Zhu, “Sequence variation in the Toxoplasma gondii eIF4A gene among strains from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 2, pp. 3356–3361, 2014. View at: Publisher Site | Google Scholar
  16. J. D. Thompson, T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins, “The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools,” Nucleic Acids Research, vol. 25, no. 24, pp. 4876–4882, 1997. View at: Publisher Site | Google Scholar
  17. N. B. Chilton, R. B. Gasser, and I. Beveridge, “Differences in a ribosomal DNA sequence of morphologically indistinguishable species within the Hypodontus macropi complex (Nematoda: Strongyloidea),” International Journal for Parasitology, vol. 25, no. 5, pp. 647–651, 1995. View at: Publisher Site | Google Scholar
  18. D. L. Swofford, PAUP. Phylogenetic Analysis Using Parsimony. Version 4.0b10, Sinauer Associates, Sunderland, Mass, USA, 2002.
  19. C. Su, X. Zhang, and J. P. Dubey, “Genotyping of Toxoplasma gondii by multilocus PCR-RFLP markers: a high resolution and simple method for identification of parasites,” International Journal for Parasitology, vol. 36, no. 7, pp. 841–848, 2006. View at: Publisher Site | Google Scholar
  20. C. Su, E. K. Shwab, P. Zhou, X.-Q. Zhu, and J. P. Dubey, “Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii,” Parasitology, vol. 137, no. 1, pp. 1–11, 2010. View at: Publisher Site | Google Scholar
  21. J. Chen, Z.-Y. Li, D.-H. Zhou, G.-H. Liu, and X.-Q. Zhu, “Genetic diversity among Toxoplasma gondii strains from different hosts and geographical regions revealed by sequence analysis of GRA5 gene,” Parasites & Vectors, vol. 5, article 279, 2012. View at: Publisher Site | Google Scholar
  22. Y. Xu, N. Z. Zhang, J. Chen et al., “Toxoplasma gondii rhoptry protein 38 gene: sequence variation among isolates from different hosts and geographical locations,” Genetics and Molecular Research, vol. 13, no. 3, pp. 4839–4844, 2014. View at: Publisher Site | Google Scholar
  23. J. L. Wang, T. T. Li, Z. Y. Li, S. Y. Huang, H. R. Ning, and X. Q. Zhu, “Rhoptry protein 47 gene sequence: a potential novel genetic marker for population genetic studies of Toxoplasma gondii,” Experimental Parasitology, vol. 154, pp. 1–4, 2015. View at: Publisher Site | Google Scholar
  24. A. Fazaeli, P. E. Carter, M. L. Darde, and T. H. Pennington, “Molecular typing of Toxoplasma gondii strains by GRA6 gene sequence analysis,” International Journal for Parasitology, vol. 30, no. 5, pp. 637–642, 2000. View at: Publisher Site | Google Scholar
  25. P. Zhou, H. Zhang, R.-Q. Lin et al., “Genetic characterization of Toxoplasma gondii isolates from China,” Parasitology International, vol. 58, no. 2, pp. 193–195, 2009. View at: Publisher Site | Google Scholar
  26. P. Zhou, H. Nie, L.-X. Zhang et al., “Genetic characterization of Toxoplasma gondii isolates from pigs in China,” Journal of Parasitology, vol. 96, no. 5, pp. 1027–1029, 2010. View at: Publisher Site | Google Scholar

Copyright © 2015 Zhong-Yuan Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views837
Downloads402
Citations

Related articles

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.