Nampt/PBEF/Visfatin Upregulation in Colorectal Tumors, Mirrored in Normal Tissue and Whole Blood of Colorectal Cancer Patients, Is Associated with Metastasis, Hypoxia, IL1β, and Anemia

Table 3

Sequences and efficiencies of primers used in current study.

Symbol	Gene name	Accession number	Primer sequence 5′→3′ (forward/reverse)	Amp. size	[%] tissue	[%] blood	[%] cells
GAPDH^a	Glyceraldehyde-3-phosphate dehydrogenase	NM_002046.4	F: gtctcctctgacttcaacagcg; R: accaccctgttgctgtagccaa	131 bp	102.1	—	—
IPO8	Importin 8; nuclear protein import	NM_006390.3	F: tggtatggtggaagtgtaagaagtg; R: ttggttgagatagttgaatgcttgc	230 bp	—	—	100.9
PPIA^a	Peptidylprolyl isomerase A	NM_021130.3	F: ggcaaatgctggacccaacaca; R: tgctggtcttgccattcctgga	161 bp	99.7	—	104.6
SDHA	Succinate dehydrogenase subunit A	NM_004168.2	F: agaggcacggaaggagtcac; R: caccacatcttgtctcatcagtagg	267 bp	—	94.8	95.9
TBP	TATA-box-binding protein	NM_003194.4	F: tataatcccaagcggtttgctg; R: ctggctcataactactaaattgttg	283 bp	—	109.7	102.2
YWHAZ	Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide; signal transduction	NM_003406.3	F: tcacaacaagcataccaagaagc; R: gtatccgatgtccacaatgtcaag	263 bp	—	—	97.4
NAMPT	Nicotinamide phosphoribosyltransferase	NM_005746.2	F: cacaggcaccactaataatcagac; R: ctccaccagaaccgaaggc	243 bp	104	108.8	94.8
IL1β^a	Interleukin 1β	NM_000576.2	F: ccacagaccttccaggagaatg; R: gtgcagttcagtgatcgtacagg	131 bp	94.7	100.1	—
IL8	Interleukin 8	NM_000584.3	F: caacacagaaattattgtaaagc; R: aagtgttgaagtagatttgc	191 bp	96.7	99.8	—
CCL2	Monocyte chemotactic protein- (MCP-) 1	NM_002982.3	F: tctgtgcctgctgctcatag; R: acttgctgctggtgattcttc	155 bp	99.7	—	—
CCL4^a	Macrophage inflammatory protein- (MIP-) 1β	NM_002984.2	F: ggtcatacacgtactcctggac; R: gcttcctcgcaactttgtggtag	140 bp	92.1	103.5	—
FGF2	Basic fibroblast growth factor	NM_002006.4	F: tctatcaaaggagtgtgtgctaacc; R: tgcccagttcgtttcagtgc	179 bp	100.7	—	—
HIF1α	Hypoxia-inducible factor 1α	NM_001530.3	F: ctgccaccactgatgaatta; R: gtatgtgggtaggagatgga	90 bp	104.7	—	—
PCNA^a	Proliferating cell nuclear antigen	NM_002592.2	F: caagtaatgtcgataaagaggagg; R: gtgtcaccgttgaagagagtgg	126 bp	100.8	—	—
TNFα^a	Tumor necrosis factor α	NM_000594.3	F: ctcttctgcctgctgcactttg; R: atgggctacaggcttgtcactc	135 bp	98.2	100.1	—
VEGF-A^a	Vascular endothelial growth factor A	NM_001025366.2	F: ttgccttgctgctctacctcca; R: gatggcagtagctgcgctgata	126 bp	96.1	94.5	—

Amp., amplicon; , efficiency; ^aprimer sequences were as proposed by Origene (http://www.origene.com/). Remaining primers were designed using Beacon Designer Probe/Primer Design Software (BioRad), validated in silico by Blast analysis, and their specificity was tested by means of melting curve analysis and an electrophoresis in a high-resolution agarose (SeaKem LE agarose, Lonza, Switzerland) in TBE with SYBR Green (Lonza) detection. Efficiencies were calculated on pooled cDNA, separately for expression analysis in whole blood, colorectal tissue, and cell culture experiments.
Forward and reverse primer sequences are denoted by “F” and “R,” respectively.