BioMed Research International / 2015 / Article / Tab 1

Research Article

Age-Specific Gene Expression Profiles of Rhesus Monkey Ovaries Detected by Microarray Analysis

Table 1

Primers used for qRT-PCR.

RefSeq transcript IDGene symbolSequence (5′ to 3′)Amplicon size (bp)

XM_001096328MRAPS: GCTGCTCCTCTTCCTCATCC
A: TCAGTTCTGCTCCCTGGCTC
204

XM_001104871MMP9S: AGTCCACCCTTGTGCTCTTC
A: CTGCCACCCGAGTGTAAC
103

NM_001042638THY1S: CCTGACCCGTGAGACAAAG
A: GGTGAAGGCGGATAAGTAGAG
127

XM_001109859LOC717872S: GTGAACGGTCGCCTGTATC
A: AAAACTGGGGTCCTTGAGC
241

XM_001097914IGFBP4S: AATTCGAGACCGGAGCAC
A: GGATGGGAATGATGTAGAGGT
170

XM_001103253NASPS: GGGCTTGGCTTATGGGT
A: ATCTCGGGTAGCAGTTCCTT
177

XM_001085259PTTG1S: GCTTTGGGAACCGTCAAC
A: TTCTGGATAGGCATCGTCTG
153

XR_011039AURKAS: TCTGTGGCACCCTGGACTA
A: AGGAGGCTTCCCAACTAAAA
119

XM_001085850BCL2L10S: GTGACAGCCTGGTGGAAGA
A: AAGCCTGGATCAGCAGTTTT
220

XM_001084147BARD1S: GAAAGCCCAAGCCAGACA
A: ACTTTGCCCTGCCGAAC
151

XM_001101192TACC3S: ATGTGCCACCCAAGAACG
A: AGCCAAAGGAGCCTCAAGT
122

XM_001095416THBDS: TGTGAGCACTTCTGCGTTCC
A: CCAGGTCGTAGCCAGGTTT
199

XM_001083479DNMT3AS: GGTTTACCCACCTGTCCCA
A: CACCTGAATGCCCAAGTCC
109

XM_001114760ZP3S: GCACTCCAAGCCATTCCA
A: GGCCCACTGCTCTACTTCATA
158

XR_010378LOC703074S: GAACTCTTCAAGCGTGTCTCA
A: CCAGGTCGTTCATGTTGCT
130

XM_001087511WASF1S: CTTTCTGCCTTGCCATTTAG
A: AGGTGGGTATCGGTTTCG
133

XR_011694LOC707199S: GACCTGAAGGACCCGTTTG
A: CAGGAGGAAGTTGTGGGAGAT
132

XM_001106702MCM3S: AAGATGGGGATTCATACGACC
A: GCCTTCAACCTGGATTCACT
139

XM_001098017IGF2BP3S: ATCTGAACGCCTTGGGTC
A: TTGCTCAAACTGCGGGTA
101

XM_001105684XRCC6S: GCGAGCACTCAGCAGGTTA
A: GTCTTGGTTTTCACTGGTTCAT
141

XM_001094077HELLSS: ACTTCCTAACTGGATGGCTGAG
A: GCTGTAACGCATTTCGGTCT
188

XM_001095697CDK1S: CCTAGCATCCCACGTCAAA
A: ATGATTCAGTGCCATTTTGC
109

XM_001093457FGF14S: CCAAGATCCCCAGCTCAA
A: TGGCAACAACACGCAGTC
158

XM_001104061UBE2CS: TATGCCTGGACATCCTGAAG
A: GGGACTATCAATGTTGGGTTC
104

XM_001093770THBS1S: GCCAGGGCGTCGAATAT
A: TGCCATTGCCAGCGTAG
168

NM_001033084.1ACTBS: GCCCTGAGGCTCTCTTCCA
A: CGGATGTCCACGTCACACTT
100

ACTB served as internal control. S: sense; A: antisense.