Table 1: Primers used for PCR amplification of interested genes.

GenePrimer (5′-3′)Annealing temperature (°C)Reference

FLNCF: GAGAGAGAGTTAGAGAGCGGTCGAGC 
R: GACCACGAAACTCGCTACGCTACG
64[13]

DLEC1F: GTTTCGTAGTTCGGTTTCGTC 
R: CGAAATATCTTAAATACGCAACG
58[14]

THBS1F: TGCGAGCGTTTTTTTAAAAGC 
R: TAAACTCGCAAACCAACTCG
60[15]

UCHL1F: GGTTCGGTCGTATTATTTCGC 
R: ACTACATCTTCGCGAAACGCCCG
62[16]