BioMed Research International / 2015 / Article / Tab 1

Research Article

Antibacterial Effects and Biocompatibility of Titania Nanotubes with Octenidine Dihydrochloride/Poly(lactic-co-glycolic acid)

Table 1

Primers used for qRT-PCR.

GeneForward primer sequence (5′-3′) Reverse primer sequence (5′-3′)

RUNX2CCTCTGACTTCTGCCTCTGGGATGAAATGCCTGGGAACTG
ALPGCCTGGACCTCATCAGCATTAGGGAAGGGTCAGTCAGGTT
OCNCAAGTCCCACACAGCAACTCCCAGGTCAGAGAGGCAGAAT
COL-IATCTCCTGGTGCTGATGGACGCCTCTTTCTCCTCTCTGACC
GAPDHGGCACAGTCAAGGCTGAGAATGATGGTGGTGAAGACGCCAGTA

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.