BioMed Research International / 2015 / Article / Tab 1

Research Article

Activation of Cannabinoid Receptor 2 Enhances Osteogenic Differentiation of Bone Marrow Derived Mesenchymal Stem Cells

Table 1

Sequences for primers.

Gene nameNCBI gene IDSequence ()Length of amplicon

Cannabinoid receptor 1 (CNR1)1268Forward: GTGTTCCACCGCAAAGATAGC
Reverse: GGGGCCTGTGAATGGATATGT
130

Cannabinoid receptor 2 (CNR2)1269Forward: AGCCCTCATACCTGTTCATTGG
Reverse: GTGAAGGTCATAGTCACGCTG
154

Runt-related transcription factor 2 (RUNX2)860Forward: TGGTTACTGTCATGGCGGGTA
Reverse: TCTCAGATCGTTGAACCTTGCTA
101

Osterix (OSX)Forward: CCTCTGCGGGACTCAACAAC
Reverse: AGCCCATTAGTGCTTGTAAAGG
128

Integrin-binding sialoprotein (IBSP)3381Forward: CACTGGAGCCAATGCAGAAGA
Reserve: TGGTGGGGTTGTAGGTTCAAA
106

Osteocalcin (OCN)632Forward: CACTCCTCGCCCTATTGGC
Reserve: CCCTCCTGCTTGGACACAAAG
112

Secreted phosphoprotein 1 (SPP1)6696Forward: GAAGTTTCGCAGACCTGACAT
Reserve: GTATGCACCATTCAACTCCTCG
91

WNT5A7474Forward: ATTCTTGGTGGTCGCTAGGTA
Reverse: CGCCTTCTCCGATGTACTGC
159

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)2597Forward: CTGGGCTACACTGAGCACC
Reserve: AAGTGGTCGTTGAGGGCAATG
101

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.