Table 1: Sequences of primers used in qRT-PCR detection.

PrimerSequenceLength

has-miR-27b-3p
 Forward5′-ACACTCCAGCTGGG TTCACAGTGGCTAAG-3′98
 Reverse5′-ATCCAGTGCAGGGTCCGAGG-3′
 RT primer CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAG GCAGAACT

has-miR-944
 Forward5′-GCGGCGGAAATTATTGTACATC-3′98
 Reverse5′-ATCCAGTGCAGGGTCCGAGG-3′
 RT primerGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCATC

CCM2
 Forward5′-GAGACCATTGGCGTGAAGGA-3′177
 Reverse5′-GATGTCCGAGATCATGCGGT-3′