Research Article
Extracellular Ribonuclease from Bacillus licheniformis (Balifase), a New Member of the N1/T1 RNase Superfamily
Table 2
Putative binding sites for transcription factors in barnase, binase, and balifase promoters.
| | Transcription factors | Barnase | Binase | Balifase |
| | AbrB (controls the expression of genes involved in starvation-induced processes) | TAAAAAAT
(125–132) | GAAAAAAG (54–61) | CAAAAATC
(119–126 noncoding strand)
CATAAACA
(219–226 noncoding strand) | | ComK (is required for the transcription of the late competence genes) | AAAGAACTATTTT (50–62) | AAAGCCTCATTTT (58–70) | Not detected | | DegU (regulates the degradative enzyme expression, genetic competence, biofilm formation, and capsule biosynthesis) | GAAAAATCCCGGCCGTTTCAG (4–24) | Not detected | ATAGTTCTCGATCGTTTTCCG
(7–27)
ACAATAATATAATGATTTTTG
(106–126) | | GerE (regulates gene transcription in the terminally differentiated mother-cell compartment during late stages of sporulation) | AAATGGGAGGTA (129–140) | AAATAAATAAAA (25–36 noncoding strand) | AAATAGTTCTCG (5–16)
ATATAATGATTT (112–123) | | Hpr (provides the link between phosphorous and carbon metabolism) | Not detected | GGTGCTATAATATGAGGTA (109–127) | ATGTTTATGTTATAAAGTC (218–236) | | PucR (regulation of purine utilization) | ATACAATGAAA (95–105) | ATTCGGAGCTG (9–19) | TTTCATGGAAA (91–101)
GTCCTCGGCTT (82–92) | | ResD (regulation of aerobic and anaerobic respiration) | AACTATTTTTAAA (54–66) | TCATTTTAGCAAA (64–76)
CTCATTTTAGCAA (63–75) | AAATTTACAATAA (100–112) | | SpoIIID (key regulator of transcription during the sporulation process) | Not detected | AGGACAGCAT (141–150)
TAGACAAGCA (126–135) | GGCACATTCT (206–215)
GGTACAATTC (139–148) |
|
|
