BioMed Research International

BioMed Research International / 2016 / Article

Research Article | Open Access

Volume 2016 |Article ID 4659470 | 15 pages | https://doi.org/10.1155/2016/4659470

Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

Academic Editor: Muhammad Abubakar
Received23 Feb 2016
Revised25 Apr 2016
Accepted18 May 2016
Published03 Aug 2016

Abstract

Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

1. Introduction

Despite the significant progress for prevention of the rabies disease and its control in the developing countries, this disease still causes over 60 thousand human deaths every year. Rabies disease is caused by infection with viruses of the family Rhabdoviridae, genus Lyssavirus [1]. Until now, fourteen species of Lyssavirus have been described in the world. Actually, the rabies virus (RABV) is the only one present in the American continent [26].

Although all mammals are susceptible to lyssaviruses, bats and carnivores are the major Lyssavirus reservoirs. In the Americas, distinct RABV variants are associated with different animals, such as foxes, coyotes, raccoons, skunks, and multiple species of nonhematophagous (frugivorous, insectivorous) and hematophagous bats [712]. In Mexico, we have been faced with less than ideal surveillance in animal populations. The reduced resources available are prioritized for diseases with overwhelming human morbidity and mortality. Accurate diagnosis and determination of RABV variants are paramount components of surveillance system and frequently are important from the perspective of veterinary and public health, when the source of exposure needs to be determined and relevant control strategies need to be implemented [13].

The direct fluorescent antibody test (FAT) is the “gold standard” for rabies diagnosis [14]; the modern conjugates used in FAT are able to detect antigens of all lyssaviruses described to date [15, 16]. Virus variants associated with certain host species can be distinguished by application of anti-nucleocapsid monoclonal antibodies (MAbs) via indirect IFA. The MAbs are still commonly used in Latin American countries, particularly in the laboratories lacking established molecular techniques [17]; these have been applied to Mexican rabies virus samples and provide data regarding the most likely reservoir species involved in rabies transmission and dissemination. Even though there has been a decrease in dog rabies, as a result of massive dog vaccination in Mexico, there is a high risk of an increase of human rabies cases transmitted from wild reservoirs as well as the simultaneous presence of more than one reservoir and more than one virus variant [1820].

The reactivity of certain viral isolates does not match the reactivity patterns in some cases [8, 1719]. Other molecular assays like the restriction analysis of RT-PCR amplified fragments of RABV genes were suggested for the differentiation of two major RABV variants but suffered from low specificity. Amplification and sequencing of viral genes followed by their phylogenetic analysis have provided more robust characterization. However, this approach requires expensive equipment and experienced laboratory staff, and it takes a relatively long processing time (typically at least 10–12 hours) [2023]. So, in this study, we designed eight pairs of primers of the RABV associated variant, which were used in a nested endpoint RT-PCR (four external and four internal primers) for the real-time RT-PCR assay, in order to detect and type the major RABV variants present in Mexico.

2. Materials and Methods

2.1. Primer Design

Primer design was based on the alignment constructed with ClustalW using complete RABV N gene sequences available in GeneBank associated variant; these were designed in consensus region. Two pairs of the primers (external and internal) were designed for each of the RABV variants associated, and the maximum average entropy (Hx) and the maximum entropy of each position were calculated using Bio Edit v7.2.5.

Two external primers and two internal primers were designed for dogs variant; 36 N gene sequences were obtained from different Mexican states; for the vampire bats variant, 18 N gene sequences were considered from Mexican states; for the nonhematophagous bat variant, the primer design comprised 50 N gene complete sequences from hosts Eptesicus, Myotis, and Nycticeius genera, distributed close to Mexico [21]; these genera are distributed from North America to Central America and have high diversity; in the case of skunks variant, 4 Mexican RABV sequences were considered; 34 RABV sequences were from USA and 13 CASK RABV sequences were from USA related to Mexican skunk rabies virus; previous studies consider two variants circulating in Mexico, MEXSK-2 and MEXSK-1 [22], located in South Baja California (SBC skunk) and Central Mexico; these are closely related and circulate predominantly in spotted skunks [23] (Table 1).


Nonhematophagous bat
GIHostCountryCollection date

AF351832.1Eptesicus fuscus (big brown bat)
GU644667.1Eptesicus fuscus (big brown bat)USA: Michigan2005
GU644664.1Eptesicus fuscus (big brown bat)USA: Michigan2003
GU644662.1Eptesicus fuscus (big brown bat)USA: Michigan2003
AY039229.1Eptesicus fuscus (big brown bat)USA: Adams County, Pennsylvania1984
AY039228.1Eptesicus fuscus (big brown bat)USA: El Paso County, Colorado1985
GU644676.1Eptesicus fuscus (big brown bat)USA: Virginia2004
GU644668.1Eptesicus fuscus (big brown bat)USA: Michigan2005
AF351862.1Eptesicus fuscus (big brown bat)
GU644655.1Eptesicus fuscus (big brown bat)USA: Iowa2005
GU644695.1Eptesicus fuscus (big brown bat)USA: Washington2005
GU644661.1Eptesicus fuscus (big brown bat)USA: Michigan2003
AY039227.1Eptesicus fuscus (big brown bat)USA: Washington1987
GU644677.1Eptesicus fuscus (big brown bat)USA: Virginia2004
GU644670.1Eptesicus fuscus (big brown bat)USA: Michigan2005
GU644666.1Eptesicus fuscus (big brown bat)USA: Michigan2005
GU644660.1Eptesicus fuscus (big brown bat)USA: Michigan2003
GU644656.1Eptesicus fuscus (big brown bat)USA: Iowa2005
GU644654.1Eptesicus fuscus (big brown bat)USA: Iowa2005
GU644690.1Eptesicus fuscus (big brown bat)USA: Washington2004
GU644669.1Eptesicus fuscus (big brown bat)USA: Michigan2005
AF351861.1Eptesicus fuscus (big brown bat)
GU644689.1Eptesicus fuscus (big brown bat)USA: Washington2004
GU644684.1Eptesicus fuscus (big brown bat)USA: Washington2003
GU644663.1Eptesicus fuscus (big brown bat)USA: Michigan2003
GU644659.1Eptesicus fuscus (big brown bat)USA: Michigan2003
GU644657.1Eptesicus fuscus (big brown bat)USA: Michigan2003
AF351833.1Eptesicus fuscus (big brown bat)
AF351828.1Eptesicus fuscus (big brown bat)
GU644665.1Eptesicus fuscus (big brown bat)USA: Michigan2005
GU644671.1Eptesicus fuscus (big brown bat)USA: New Jersey2005
GU644658.1Eptesicus fuscus (big brown bat)USA: Michigan2003
GU644652.1Eptesicus fuscus (big brown bat)USA: Georgia2004
AF351831.1Eptesicus fuscus (big brown bat)
AF351855.1Eptesicus fuscus (big brown bat)
GU644754.1Nycticeius humeralis (evening bat )USA: Florida2001
AF351854.1Eptesicus fuscus (big brown bat)
AF394868.1Antrozous pallidus (pallid bat)USA: Monterey, California1991
AY039225.1Myotis austroriparius (southeastern myotis bat)USA: Highlands County, Florida1988
AF351829.1Eptesicus fuscus (big brown bat)
AF394871.1Myotis californicus (California bat)USA: Plumas County, California1987
AF351859.1Eptesicus fuscus (big brown bat)
AF351860.1Eptesicus fuscus (big brown bat)
GU644673.1Eptesicus fuscus (big brown bat)USA: New Jersey2005
AY039226.1Eptesicus fuscus (big brown bat)USA: Perry County, Pennsylvania1984
AF351839.1Myotis sp. (bat)
AF351853.1Eptesicus fuscus (big brown bat)
HQ341796.1Myotis chiloensis (bat)Chile2009
AF351827.1Eptesicus fuscus (big brown bat)
GU644675.1Eptesicus fuscus (big brown bat)USA: New Jersey2005

Skunk
GIHostCountryCollection date

JQ513553Skunk V854Mexico: San Luis Potosí2002
JQ513552Skunk V658USA: Mariposa County, California1997
JQ513548Skunk V652USA: Mariposa County, California1997
JQ513547Skunk V651USA: Mariposa County, California1997
JQ513551Fox V657USA: Mariposa County, California1997
JQ513541Dog V640USA: Sonoma County, California1994
JQ513546SkunkUSA: Trinity County, California1997
JQ513542Mountain lionUSA: Yolo County, California1994
JQ513545SkunkUSA: Mendocino County, California1997
JQ513549SkunkUSA: Amador County, California1997
JQ513539SkunkUSA: Glenn County, California1994
JQ513544SkunkUSA: Colusa County, California1994
JQ513540SkunkUSA: Sutter County, California1994
JQ513550SkunkUSA: Glenn County, California1997
FJ228485CowMexico: Chihuahua1999
FJ228484Spilogale putorius leucoparia, skunkMexico: San Luis Potosí2002
FJ228483Spilogale putorius leucoparia, skunkMexico: Zacatecas2001
JX856026.1Mephitis mephitis (striped skunk)USA2009
JX856036.1 Bovine (cow)USA2009
JX856035.1Mephitis mephitis (striped skunk)USA2009
JX855972.1Felis silvestris (bobcat)USA2009
JX856024.1Mephitis mephitis (striped skunk)USA2009
JX856023.1 Bovine (cow)USA2009
JX856017.1 Bovine (cow)USA2009
JX856016.1Mephitis mephitis (striped skunk)USA2009
JX856015.1Mephitis mephitis (striped skunk)USA2009
JX856014.1Mephitis mephitis (striped skunk)USA2009
JX856006.1Mephitis mephitis (striped skunk)USA2009
JX856004.1Mephitis mephitis (striped skunk)USA2009
JX856001.1Mephitis mephitis (striped skunk)USA2009
JX855993.1Mephitis mephitis (striped skunk)USA2009
JX855990.1Mephitis mephitis (striped skunk)USA2009
JX855980.1Felis catus (cat)USA2009
JX855988.1Mephitis mephitis (striped skunk)USA2009
JX855987.1Mephitis mephitis (striped skunk)USA2009
JX855986.1Mephitis mephitis (striped skunk)USA2009
JX855985.1Mephitis mephitis (striped skunk)USA2009
JX855984.1Mephitis mephitis (striped skunk)USA2009
JX855981.1Mephitis mephitis (striped skunk)USA2009
JX855979.1Felis catus (cat)USA2009
JX855973.1Mephitis mephitis (striped skunk)USA2009
JX855976.1Canis lupus familiaris (dog)USA2009
JX855975.1Mephitis mephitis (striped skunk)USA2009
JX855974.1Mephitis mephitis (striped skunk)USA2009
JX855970.1Mephitis mephitis (striped skunk)USA2009
JX855968.1Mephitis mephitis (striped skunk)USA2009
JX855967.1Mephitis mephitis (striped skunk)USA2009
JX855966.1Mephitis mephitis (striped skunk)USA2009
JX855965.1Equus caballus (horse)USA2009
JX855963.1Mephitis mephitis (striped skunk)USA2009
JX855962.1Mephitis mephitis (striped skunk)USA2009

Dog
GIHostCountryCollection date

FJ228513.1Canis lupus familiaris (dog)Mexico: Estado de México2000
FJ228512.1 Canis lupus familiaris (dog)Mexico: Estado de México2002
FJ228507.1Canis lupus familiaris (dog)Mexico: Estado de México1999
FJ228532.1Canis lupus familiaris (dog)Mexico: Puebla1995
FJ228506.1Canis lupus familiaris (dog)Mexico: Guerrero1999
FJ228505.1Canis lupus familiaris (dog)Mexico: Tlaxcala2002
FJ228504.1Canis lupus familiaris (dog)Mexico: Puebla2001
FJ228503.1Canis lupus familiaris (dog)Mexico: Tlaxcala2000
FJ228502.1Canis lupus familiaris (dog)Mexico: Distrito Federal1999
KJ001535.1Canis lupus familiaris (dog)Mexico2005
KJ001525.1Canis lupus familiaris (dog)Mexico2009
KJ001524.1Canis lupus familiaris (dog)Mexico2005
KJ001518.1Canis lupus familiaris (dog)Mexico2011
KJ001517.1Canis lupus familiaris (dog)Mexico2011
KJ001516.1Canis lupus familiaris (dog)Mexico2011
KJ001515.1Canis lupus familiaris (dog)Mexico2011
KJ001509.1Canis lupus familiaris (dog)Mexico2009
KJ001502.1Canis lupus familiaris (dog)Mexico2006
KJ001500.1Canis lupus familiaris (dog)Mexico2006
KJ001499.1Canis lupus familiaris (dog)Mexico2006
KJ001492.1Canis lupus familiaris (dog)Mexico2005
KJ001490.1Canis lupus familiaris (dog)Mexico2005
KJ001488.1Canis lupus familiaris (dog)Mexico2005
FJ228525.1Canis lupus familiaris (dog)Mexico: Yucatán2002
FJ228523.1Canis lupus familiaris (dog)Mexico: Yucatán1998
FJ228521.1Canis lupus familiaris (dog)Mexico: Durango1991
FJ228518.1Canis lupus familiaris (dog)Mexico: Chiapas2002
FJ228511.1Bos taurus (cow)Mexico: Puebla1994
FJ228510.1Sus scrofa domesticus (pig)Mexico: Distrito Federal1991
FJ228509.1Mustela putorius furo (ferret)Mexico: Distrito Federal1990
FJ228508.1Homo sapiens (human)Mexico: Distrito Federal1991
FJ228522.1Bos taurus (cow)Mexico: Chihuahua1994
FJ228519.1Felis catus (cat)Mexico: Michoacán1990
AY854591.1Canis lupus familiaris (dog)Mexico
AY854589.1Canis lupus familiaris (dog)Mexico
FJ228526.1Canis latrans (coyote)Mexico: Coahuila2001

Vampire bat
GU991828.1Desmodontinae (vampire bat V3)
GU991827.1Desmodontinae (vampire bat V3)Mexico: East Mexico1999
GU991826.1Desmodontinae (vampire bat V3)Mexico: East Mexico1999
GU991825.1Desmodontinae (vampire bat V3)Mexico: East Mexico2004
GU991824.1Desmodontinae (vampire bat V11)Mexico: East Mexico2002
GU991823.1Desmodontinae (vampire bat V11)East Mexico2003
KP202393.1Desmodontinae (vampire bat)Mexico1988
AY854592.1Desmodontinae (vampire bat)Mexico
AY854587.1Desmodontinae (vampire bat)Mexico
AY854595.1Desmodontinae (vampire bat)Mexico
AY854594.1Desmodontinae (vampire bat)Mexico
FJ228491.1Bos taurus (cow)Mexico: Tamaulipas2003
FJ228490.1Bos taurus (cow)Mexico: Veracruz2003
FJ228489.1Ovis aries (sheep)Mexico: Hidalgo2003
FJ228488.1Bos taurus (cow)Mexico: San Luis Potosí2004
AY877435.1Desmodontinae (vampire bat)
AY877434.1Desmodontinae (vampire bat)
AY877433.1Desmodontinae (vampire bat)

2.2. Samples

Twenty-three brain samples collected in Mexico were used as follows: nine brain samples tested negative by FAT and fourteen tested positive by FAT and typed by MAbs: these RABV isolated consisted of six samples of dog brain, one sample of skunk, two samples of cow, two samples of vampire bat, and three samples of nonhematophagous bat (Table 2).


SampleSample nameHost speciesAntigenic variant

168EDOMEXDOG05Dog 068V1
2647EDOMEXDOG05Dog 647V1
3659EDOMEXDOG05Dog 659V1
4748EDOMEXDOG05Dog 748V1
52293EDOMEXDOG05Dog 2293V1
6885EDOMEXDOG05Dog 885V1
7658EDOMEXCOW05Cow 658V8
8460EDOMEXCOW11Cow 460V8
9757EDOMEXMUR06Bat nonhematophagous 757 A
101594EDOMEXVAM07Bat nonhematophagous 1594V5
111079EDOMEXMUR08Bat nonhematophagous 1079None
123919EDOMEXVAM05Vampire bat 3919None
13110EDOMEXVAM06Vampire bat 110Atypical
141369EDOMEXSK06Skunk 1369V8
1565EDOMEXDOG05DogNA
16543EDOMEXDOG05DogNA
17642EDOMEXDOG05DogNA
18223EDOMEXDOG05SkunkNA
191001EDOMEXDOG05SkunkNA
20455EDOMEXDOG05CowNA
21755EDOMEXDOG05Bat nonhematophagousNA
222187EDOMEXDOG05Vampire batNA
23Negative controlCNNA

All samples are from Mexican state. Varian antigenic test: V1, dog; V5, Tadarida brasiliensis; V8, skunk; V11, vampire bat; A, atypical; NA, not applicable; AC Number: sequences refer to NCBI accession number (http://www.ncbi.nlm.nih.gov/).
2.3. Nucleic Acid Extraction

The brain tissues (approximately 3 mm3) were homogenized in 200 μL of lysis/binding buffer using MagNA Lyser Green Beads (Roche, Germany) and MagNA Lyser (Roche Applied Science, Germany). Total RNA was extracted from the homogenates using MagNA Pure LC Total Nucleic Acid Isolation kit (Roche, Germany) and MagNA Pure LC 2.0 (Roche Applied Science, Germany) following the manufacturer’s instructions. Total RNA was eluted in 200 μL buffer elution and quantified into Nanodrop (Invitrogen); RNA concentration was calculated considering  ng/μL, and all samples were adjusted at 20 ng/L of final concentration with elution buffer.

2.4. Nested RT-PCR Amplification and Sequence Determination

The reverse transcription reaction was performed using four singleplex reactions with external primers and SuperScript®III Platinum® One-Step qRT-PCR kit (Invitrogen) in 50 μL of reaction mixture containing 25 μL of 2x reaction mix, 1 μL of forward sense primer (10 μM), 1 μL of reverse sense primer (10 μM), 1 μL SuperScript III RT/Platinum TaqMix, 17 μL of DEPC-treated water, and 5 μL RNA extracted (20 ng/μL). Amplification was performed in C1000 Thermal Cycler (Bio-Rad, USA) using the following program: one cycle of RT at 50°C for 30 min, followed by denaturation at 92°C for 3 min, 35 cycles with denaturation at 92°C for 30 s, annealing at primer-specific temperature (Table 3) for 30 s, and elongation at 72°C for 1 min, with the final extension at 72°C for 4 min.


Primer nameSequence (3′ to 5′)SenseRabies variant detectionFragment size (pb)Tm (°C)Length (pb)

EVAMPIROFTTCAAGGTCAATAATCAGGTGGTCTCTCFVampire bat8365922–49
VAMPIRORCAGACTGCTGTTCCTCATTCCTATTTR53.8833–857
IFBVFQATTGGGCTCTAACAGGGGGCATF17759.6356–377
FBVRCQATAGAGCAGATTTTCGAGACAGCCCCCTR62.5575–602

EPERROFTTCAAAGTCAATAATCAGGTGGTCFDog128851.922–45
PERRORCAATCATCAAGCCCGTCCAAACTR56.41288–1309
IFBPFQCAAGAATATGAGGCGGCTGAACTF212551099–1120
PERRORCAATCATCAAGCCCGTCCAAACTR56.41288–1309

EMURCIELAGOFGACCCTGATGATGTATGCTCTTATFBat 66851196–219
MURCIELAGORCGTTCCTCACTCYTATTTCATCCAR50.6742–764
IFBMFQGCTTGACCCTGATGATGTATGCTCTTATF18459192–219
FBMRCQTGGGCTCTAACAGGGGGTATGGR58.7358–379

EZORRILLOFATAGAACAGATTTTTGAGACGGCFSkunk79451.4505–527
ZORRILLORCTGTCTCAGTTAGTTCCAATCATCAAGCR56.91272–1298
IZORRILLOFATAGAACAGATTTTTGAGACGGCF35951.4506–527
FBZRCQGTTCCTCACTCCTATTTCATCCAR51.7742–764

Nested endpoint PCR and real-time RT-PCR primers designed. E: external; I: internal; F: forward; R: reverse. According to RABV strain SAD VA1 sequence.

For nested PCR, 1 μL of the primary amplification products was added to a new singleplex PCR reaction using internal primers and Taq DNA polymerase kit; in a 50 μL total volume, add 5 μL 10x PCR buffer, 1 μL of 1x dNTP mix (200 μM of each dNTP), 1 μL internal forward primer, 1 μL internal reverse primer, 0.25 μL Taq DNA polymerase (1.25 units/reaction), 1 μL of primary amplification, and 40.75 μL RNase-free water. The thermal program consisted of a first cycle of 2 min at 94°C, followed by 35 repetitive cycles of denaturation of 1 min at 93°C, 1 min of annealing at the primer-specific temperature (Table 3), 1 min of elongation at 72°C, and the final elongation at 72°C for 4 min. The four singleplex RT-PCR and four nested PCR products were analyzed in 1-2% agarose gel. Bands of the expected size were excised, purified, and cloned in TOPO-TA vector (Invitrogen, Carlsbad, USA). The resulting plasmids were purified from E. coli colonies using Pure Link Quick Plasmid Miniprep kit (Invitrogen), sequenced with the universal M13 primers (Macrogen, Korea), and analyzed with MEGA 6.06 [24].

2.5. Real-Time RT-PCR with SYBR Green

The one-step real-time PCR was performed using internal primers and LCFastStart RNA Master SYBR Green I kit (Roche, Germany) in 20 μL of total volume, four singleplex reactions including 100 ng total of total RNA and 0.01 μM of each internal pair of primers for RABV associated variant (Table 3). Amplification was performed in LightCycler 2.0 (Roche, Germany) using the following program: one cycle of RT at 55°C for 30 min, followed by denaturation at 95°C for 30 s, 40 cycles with denaturation at 95°C for 10 s, annealing at 60°C for 15 s, and elongation at 72°C for 25 s. The measurement of the fluorescent signal was carried out during the extension phase at 530 nm. By the end of the amplification test, an analysis of the dissociation curves from the product was made to ensure the absence of hairpin and dimer formation. Hybridization temperatures and primer concentrations were optimized for each reaction based on the preliminary standardization experiments.

3. Results

The set of primers for specific RABV variants was designed aligning the sequence of N gene region. Four regions highly conserved were selected for two external primers and two internal primers designed, with more than 90% of conservation, for each variant and high variability between variants. Two mismatches were permitted for the primers design, and less was possible for the internal primers located at the primers beginning or end.

As the maximum entropy values increased, the number of identified conserved regions, their length, the coverage of conserved regions, and the average length of single conserved regions also increased. Two external primers and two internal primers were designed for dog-associated variant; the alignment presented a high conservation level (Figure 1). The maximum average entropy (Hx) was 0.04 and the maximum entropy of each position was 0.97. In the case of the set of primers for skunk-associated variant, the alignment presented high conservation level (Figure 2). The maximum average entropy (Hx) was 0.19 and the maximum entropy of each position was 0.99. The alignment of the set of primers for vampire bat-associated variant showed a high conservation level (Figure 3). The maximum average entropy (Hx) was 0.04 and the maximum entropy of each position was 0.98. Finally, the alignment of the set of primers for nonhematophagous bat-associated variant presented high conservation level (Figure 4). The maximum average entropy (Hx) was 0.07 and the maximum entropy of each position was 0.97 on average; this means that, at the same position of every base, a few sequences of alignment of the associated variant differed from the others and thus were considered conservative; with respect to the maximum average entropy, the variant associated with more differences was the nonhematophagous bat-associated variant (Figure 4).

The sequences and locations of the two pairs of variant-specific primers are listed in Table 3. Even when the melting temperature is similar between them, the sequence is dependent on the specific host variant.

All brain samples from Mexican host mammals were diagnosed as negative or positive in FAT, with a corresponding signal in the nested RT-PCR assay. A positive control for each variant was performed using a positive example previously MAbs tested. In the first step, the external amplification produced a single band of 608–1187 bp, while the second amplification of the primary PCR products with the internal primer showed products of 200–400 bp. To complement the nested information, one-step RT-PCR as well as the second nested RT-PCR was performed with external primers and the same samples (Figure 5).

The optimal annealing temperature for external RT-PCR was in the range 48–55°C and was 56°C in the case of nested RT-PCR. Optimal concentration of Mg2+ was in the order of 2.5–3 mM for both RT-PCR and nested RT-PCR reaction mixtures.

3.1. RT-PCR SYBR Green

For real-time RT-PCR assay, we used the internal primers (Table 3). This technique had an optimal annealing temperature of 60°C from four pairs of primers, and the dissociation temperature curves were as follows: 85.50°C for skunk specific variant, 80.19°C for dog-associated variant, 83.96°C for bat-associated variant, and 85.23°C for vampire bat specific variant (Figure 6).

3.2. Comparison of Diagnostic Methods

A total of twenty-three samples were assessed as follows: nine negative-control samples performed by nested or real-time RT-PCR assays showed no positive detection with the internal and external primers; previously, fourteen positive-RABV variants samples were tested by FAT; eleven of them were categorized with monoclonal antibodies resulting in six positive to variant 1 (V1), three to V8, one to V5, two atypical variants, and two undetected. The RABV specific variant characterizations to dog, vampire bat, nonhematophagous bat, and skunk were determined by real-time RT-PCR using external primers. However, to prevent cross-reaction and to increase sensitivity in the nested PCR, internal primers were used to confirm thus the abovementioned variants. In addition, real-time PCR detection using internal primers confirmed the reservoir variant with dissociation temperatures of 60°C. The amplified fragments were sequenced with a subsequent analysis by BLAST; this analysis confirmed the reservoir for nested PCR and real-time RT-PCR (Table 4).


SampleHostFATAntigenic variantExternal RT-PCRInternal PCRSYBR GreenGenBank sequence
AC number (N gene)
DVBSdvbsdvbs

1Dog 0068+V1JQ037820
2Dog 647+V1JQ037819
3Dog 659+V1JQ037823
4Dog 748+V1JQ037821
5Dog 2293+V1JQ037824
6Dog 885+V1JQ037822
7Cow 658+V8JQ037825
8Cow 2688+V8JQ037826
9Bat nonhematophagous 757+AJQ037830
10Bat nonhematophagous 1594+V5JQ037829
11Bat nonhematophagous 1079+NoneJQ037831
12Vampire bat 3919+NoneJQ037827
13Vampire bat 110+AtypicalJQ037828
14Skunk 1369+V8JQ037818
1565EDOMEXDOG05NA
16543EDOMEXDOG05NA
17642EDOMEXDOG05NA
18223EDOMEXDOG05NA
191001EDOMEXDOG05NA
20455EDOMEXDOG05NA
21755EDOMEXDOG05NA
222187EDOMEXDOG05NA
23Negative controlNA

FAT: fluorescent antibody test; Varian antigenic test: V1, dog; V5, Tadarida brasiliensis; V8, skunk; V11, vampire bat; A, atypical; positive diagnosis. Capital letter: positive external RT-PCR; lowercased letter: positive internal PCR; italic letter: positive SYBR Green. Variants were represented in the following sense: D, dog; V, vampire; B, bat; and S, skunk. Sequences refer to NCBI accession number (http://www.ncbi.nlm.nih.gov/).
3.3. Sensitivity of nRT-PCR and SYBR Green

Twenty-three brain samples were analyzed as follows: nine negative-control samples and fourteen positive samples were confirmed by nucleotide sequencing. Regarding the results of the nested PCR and real-time PCR assays of the brain samples, they showed 100% sensitivity (100% CI: 76.84% to 100.00%) and 100% specificity (100% CI: 66.37% to 100%).

4. Discussion

In some studies of antigenic characterization of rabies virus, a panel of eight anti-N protein monoclonal antibodies (MAbs) has been used, which can differentiate between eleven distinct variants harbored by a variety of terrestrial and chiropteran hosts [25, 26]. Application of this panel to rabies virus collections from many Latin American countries has identified two major variants, associated with dog and vampire bat (Desmodus rotundus), as well as other variants associated with several insectivorous bats, including the free-tailed bat (Tadarida brasiliensis) and the hoary bat (Lasiurus cinereus) [27].

Real-time RT-PCR techniques have been used for diagnosis and genotyping of all the Lyssavirus genus including the RABV [28]. The nested RT-PCR assay, which requires both multiple transfers of material and substantial time, is sufficient to detect virus from each virus-positive brain sample [29] and therefore still offers a useful tool for variants rabies diagnosis where conventional PCR technology exists.

The real-time RT-PCR detection with SYBR Green, where the specificity is being given by the primers, is an easy-to-use assay to detect infected brain material in a single tube test and, consequently, is an attractive option for laboratory use as a screening surveillance tool. In the present study, these latest technologies for typing the RABV variants depending on the host (vampire bat, skunk, dog, and bat) were used.

The real-time RT-PCR detection with SYBR Green, whose specificity is given by the primers, is an easy-to-use assay to detect infected brain material in a single tube test and, consequently, is an attractive option for laboratory use as a screening surveillance tool. In the present study, these latest technologies for typing the RABV associated variants on the host (vampire bat, skunk, dog, and bat) were used.

In the design with highly specific primers from the conserved region from the nucleoprotein of RABV, the maximum average entropy (Hx) was in the order of 0.03–0.19 and the maximum entropy of each position was 0.97–0.99. In addition, the positions of different primers in N gene sequence are close but different for variant host, increasing the specificity.

The current gold standard test has been and is the fluorescent antibody test (FAT), which uses a conjugated monoclonal antibody against the RABV nucleoprotein. Although it is cheaper, some laboratories have no access to MAbs but have PCR and/or real-time technology.

In the characterization of the antigenic variants (AgV) with MAbs in the dog samples, the dog variant-specific primers identified the dog variant (V1). This result matched both the nRT-PCR and SYBR Green primers at 100%. Similarly, the skunk samples matched the same percentage with skunk variant-specific primers. Furthermore, in the bovine samples where the MAbs detection identified the skunk variant (V8), the determined host by nRT-PCR and SYBR Green was diagnosed as positive with the vampire primers, with this last result confirmed by sequences and AC Numbers JQ037818 to JQ037831 (Table 1). The real-time RT-PCR result coincides with some other studies where rabies transmission from vampire bats to bovines has been described.

The MAbs detection in nonhematophagous bat was V5 bat, a result which coincides with both nRT-PCR and SYBR Green with the bat primer. The vampire bat 110 sample was determined as atypical and the vampire bat 3919 was not determined with the MABs; however, both samples were diagnosed as positive with the bat primers for nRT-PCR and SYBR Green.

In some cases, the classification of certain rabies virus isolates by monoclonal panel can obtain nontypical reactivity patterns and is not assigned to any known variant, as found in certain Argentinian rabies viruses [12]. The application of molecular genetic techniques for characterization of viral collections can assist in resolving such typing difficulties.

In the hematophagous bat samples determined as atypical and the one not determined with the MAbs, it was concluded that the host was a vampire bat by nRT-PCR and SYBR Green detection. This may have occurred due to the high sensitivity of the RT-PCR molecular technique, as it has been shown in studies where positive results in brains analysis were demonstrated by nRT-PCR and negative results by FAT [30, 31]. In all results, the host was confirmed by the amplicon sequencing. The access numbers are shown in Table 4.

According to the RABV variant detection, the external primers and internal primers detect a specific variant and do not present cross-reaction between them, and the final result is given for the internal primer reaction in nested and/or RT-PCR real time, as they were obtained in different samples (Table 5).


Rabies variant detection/primer nameVAMPIROF-VAMPIRORCFBVFQ-FBVRCQPERROF-PERRORCFBPFQ-PERRORCMURCIELAGOF-MURCIELAGORCFBMFQ-FBMRCQZORRILLOF-ZORRILLORCZORRILLOF-FBZRCQ

Vampire bat
Dog
Bat
Skunk

Only a sample can be considered positive if the result with the internal primers is positive regardless of the outcome of the external primers, for nested and/or real-time RT-PCR.

In addition, this study showed 100% sensitivity and 100% specificity assessed by nRT-PCR and real-time RT-PCR with SYBR Green. These findings are an early estimate by what is required of a greater number of related studies, increasing the number of samples to obtain better sensitivity and specificity evaluation. However, this assay could be useful, for institutions without access to MAbs and those that have PCR and/or real-time technology as an alternative.

The relevance of the present study falls in the rabies virus typing from original host-brains samples and the association with the variant-specific host performed by nested endpoint PCR or real-time RT-PCR assays. Previous studies report the detection in decomposed brains from dogs and humans samples [32]; in humans exhumed between 8 and 30 days after burial [27]; in wolves by nested RT-PCR [33]; in mice previously infected by heminested RT-PCR [29]; and in bats and herbivores by RT-PCR.

The sequence obtained for this study, a splitting between the urban rabies (dog) and the sylvan rabies (bat, vampire bat, and skunk), was shown in Tables 4 and 5; the results were according to the primers designed associated variant for the dog (urban rabies) and bat, skunk, and vampire bat (sylvan rabies).

5. Conclusion

This study describes the development of an alternative tool for RABV typifying in real-time RT-PCR and/or nested RT-PCR, considering dog, skunk, vampire bat, and nonhematophagous bat specific variants.

Competing Interests

The authors declare that they have no competing interests.

Acknowledgments

The authors would like to acknowledge Lizdah Ivette García Rodríguez and José A. Valdes-Zúñiga, Unidad de Enseñanza, Investigación y Calidad, for supporting the administrative project permission and formats, IPN: COFAA SIP.

References

  1. R. Vaccines, “Releve epidemiologique hebdomadaire,” Weekly Epidemiological Record/Health Section of the Secretariat of the League of Nations, vol. 82, no. 49-50, pp. 425–435, 2007. View at: Google Scholar
  2. Y. T. Arai, K. Yamada, Y. Kameoka et al., “Nucleoprotein gene analysis of fixed and street rabies virus variants using RT-PCR,” Archives of Virology, vol. 142, no. 9, pp. 1787–1796, 1997. View at: Publisher Site | Google Scholar
  3. H. Badrane, C. Bahloul, P. Perrin, and N. Tordo, “Evidence of two Lyssavirus phylogroups with distinct pathogenicity and immunogenicity,” Journal of Virology, vol. 75, no. 7, pp. 3268–3276, 2001. View at: Publisher Site | Google Scholar
  4. G. M. Baer, “Rabies—an historical perspective,” Infectious Agents and Disease, vol. 3, no. 4, pp. 168–180, 1994. View at: Google Scholar
  5. E. M. Black, L. M. McElhinney, J. P. Lowings, J. Smith, P. Johnstone, and P. R. Heaton, “Molecular methods to distinguish between classical rabies and the rabies-related European bat lyssaviruses,” Journal of Virological Methods, vol. 87, no. 1-2, pp. 123–131, 2000. View at: Publisher Site | Google Scholar
  6. H. Bourhy, B. Kissi, M. Lafon, D. Sacramento, and N. Tordo, “Antigenic and molecular characterization of bat rabies virus in Europe,” Journal of Clinical Microbiology, vol. 30, no. 9, pp. 2419–2426, 1992. View at: Google Scholar
  7. C. C. De Mattos, C. A. De Mattos, E. Loza-Rubio, A. Aguilar-Setién, L. A. Orciari, and J. S. Smith, “Molecular characterization of rabies virus isolates from Mexico: implications for transmission dynamics and human risk,” The American Journal of Tropical Medicine and Hygiene, vol. 61, no. 4, pp. 587–597, 1999. View at: Google Scholar
  8. S. A. Nadin-Davis, G. A. Casey, and A. Wandeler, “Identification of regional variants of the rabies virus within the Canadian province of Ontario,” The Journal of General Virology, vol. 74, part 5, pp. 829–837, 1993. View at: Publisher Site | Google Scholar
  9. J. S. Smith, L. A. Orciari, P. A. Yager, H. D. Seidel, and C. K. Warner, “Epidemiologic and historical relationships among 87 rabies virus isolates as determined by limited sequence analysis,” The Journal of Infectious Diseases, vol. 166, no. 2, pp. 296–307, 1992. View at: Publisher Site | Google Scholar
  10. H. Bourhy, B. Kissi, and N. Tordo, “Molecular diversity of the Lyssavirus genus,” Virology, vol. 194, no. 1, pp. 70–81, 1993. View at: Publisher Site | Google Scholar
  11. H. Bourhy, J.-M. Reynes, E. J. Dunham et al., “The origin and phylogeography of dog rabies virus,” Journal of General Virology, vol. 89, no. 11, pp. 2673–2681, 2008. View at: Publisher Site | Google Scholar
  12. D. Cisterna, R. Bonaventura, S. Caillou et al., “Antigenic and molecular characterization of rabies virus in Argentina,” Virus Research, vol. 109, no. 2, pp. 139–147, 2005. View at: Publisher Site | Google Scholar
  13. E. W. Lankau, N. J. Cohen, E. S. Jentes et al., “Prevention and control of rabies in an age of global travel: a review of travel- and trade-associated rabies events—United States, 1986–2012,” Zoonoses and Public Health, vol. 61, no. 5, pp. 305–316, 2014. View at: Publisher Site | Google Scholar
  14. D. J. Dean and M. K. Abelseth, “Laboratory techniques in rabies: the fluorescent antibody test,” Monograph Series of the World Health Organization, no. 23, pp. 73–84, 1973. View at: Google Scholar
  15. O. Delmas, E. C. Holmes, C. Talbi et al., “Genomic diversity and evolution of the lyssaviruses,” PLoS ONE, vol. 3, no. 4, Article ID e2057, 2008. View at: Publisher Site | Google Scholar
  16. D. L. Horton, A. C. Banyard, D. A. Marston et al., “Antigenic and genetic characterization of a divergent African virus, Ikoma lyssavirus,” The Journal of General Virology, vol. 95, no. 5, pp. 1025–1032, 2014. View at: Publisher Site | Google Scholar
  17. E. Picard-Meyer, J. Barrat, and F. Cliquet, “Use of filter paper (FTA) technology for sampling, recovery and molecular characterisation of rabies viruses,” Journal of Virological Methods, vol. 140, no. 1-2, pp. 174–182, 2007. View at: Publisher Site | Google Scholar
  18. A. Velasco-Villa, M. Gómez-Sierra, G. Hernández-Rodríguez et al., “Antigenic diversity and distribution of rabies virus in Mexico,” Journal of Clinical Microbiology, vol. 40, no. 3, pp. 951–958, 2002. View at: Publisher Site | Google Scholar
  19. D. M. M. Mattos, M. L. Gomes, R. S. Freitas, P. C. Rodrigues, E. F. Paula, and M. Bernardo-Filho, “A model to evaluate the biological effect of natural products: vincristine action on the biodistribution of radiopharmaceuticals in BALB/c female mice,” Journal of Applied Toxicology, vol. 19, no. 4, pp. 251–254, 1999. View at: Publisher Site | Google Scholar
  20. E. Loza-Rubio, A. Aguilar-Setién, C. Bahloul, B. Brochier, P. P. Pastoret, and N. Tordo, “Discrimination between epidemiological cycles of rabies in Mexico,” Archives of Medical Research, vol. 30, no. 2, pp. 144–149, 1999. View at: Publisher Site | Google Scholar
  21. D. G. Streicker, P. Lemey, A. Velasco-Villa, and C. E. Rupprecht, “Rates of viral evolution are linked to host geography in bat rabies,” PLoS Pathogens, vol. 8, no. 5, Article ID e1002720, 2012. View at: Publisher Site | Google Scholar
  22. A. Velasco-Villa, S. A. Reeder, L. A. Orciari et al., “Enzootic rabies elimination from dogs and reemergence in wild terrestrial carnivores, United States,” Emerging Infectious Diseases, vol. 14, no. 12, pp. 1849–1854, 2008. View at: Publisher Site | Google Scholar
  23. R. Davis, S. A. Nadin-Davis, M. Moore, and C. Hanlon, “Genetic characterization and phylogenetic analysis of skunk-associated rabies viruses in North America with special emphasis on the central plains,” Virus Research, vol. 174, no. 1-2, pp. 27–36, 2013. View at: Publisher Site | Google Scholar
  24. K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, “MEGA6: molecular evolutionary genetics analysis version 6.0,” Molecular Biology and Evolution, vol. 30, no. 12, pp. 2725–2729, 2013. View at: Publisher Site | Google Scholar
  25. H. A. Delpietro, F. Gury-Dhomen, O. P. Larghi, C. Mena-Segura, and L. Abramo, “Monoclonal antibody characterization of rabies virus strains isolated in the River Plate Basin,” Journal of Veterinary Medicine, Series B, vol. 44, no. 8, pp. 477–483, 1997. View at: Publisher Site | Google Scholar
  26. A. M. Diaz, S. Papo, A. Rodriguez, and J. S. Smith, “Antigenic analysis of rabies-virus isolates from Latin America and the Caribbean,” Zentralblatt fur Veterinarmedizin. Reihe B. Journal of veterinary medicine. Series B, vol. 41, no. 3, pp. 153–160, 1994. View at: Google Scholar
  27. S. R. Favoretto, M. L. Carrieri, E. M. S. Cunha et al., “Antigenic typing of Brazilian rabies virus samples isolated from animals and humans, 1989–2000,” Revista do Instituto de Medicina Tropical de Sao Paulo, vol. 44, no. 2, pp. 91–95, 2002. View at: Google Scholar
  28. A. R. Fooks, N. Johnson, C. M. Freuling et al., “Emerging technologies for the detection of rabies virus: challenges and hopes in the 21st century,” PLoS Neglected Tropical Diseases, vol. 3, no. 9, article e530, 2009. View at: Publisher Site | Google Scholar
  29. P. R. Heaton, P. Johnstone, L. M. McElhinney, R. Cowley, E. O'Sullivan, and J. E. Whitby, “Heminested PCR assay for detection of six genotypes of rabies and rabies-related viruses,” Journal of Clinical Microbiology, vol. 35, no. 11, pp. 2762–2766, 1997. View at: Google Scholar
  30. E. Loza-Rubio, E. Rojas-Anaya, V. M. Banda-Ruíz, S. A. Nadin-Davis, and B. Cortez-García, “Detection of multiple strains of rabies virus RNA using primers designed to target Mexican vampire bat variants,” Epidemiology and Infection, vol. 133, no. 5, pp. 927–934, 2005. View at: Publisher Site | Google Scholar
  31. R. M. Soares, F. Bernardi, S. M. Sakamoto et al., “A heminested polymerase chain reaction for the detection of Brazilian rabies isolates from vampire bats and herbivores,” Memorias do Instituto Oswaldo Cruz, vol. 97, no. 1, pp. 109–111, 2002. View at: Publisher Site | Google Scholar
  32. N. Kamolvarin, T. Tirawatnpong, R. Rattanasiwamoke, S. Tirawatnpong, T. Panpanich, and T. Hemachudha, “Diagnosis of rabies by polymerase chain reaction with nested primers,” The Journal of Infectious Diseases, vol. 167, no. 1, pp. 207–210, 1993. View at: Publisher Site | Google Scholar
  33. J. E. Whitby, P. R. Heaton, H. E. Whitby, E. O'Sullivan, and P. Johnstone, “Rapid detection of rabies and rabies-related viruses by RT-PCR and enzyme-linked immunosorbent assay,” Journal of Virological Methods, vol. 69, no. 1-2, pp. 63–72, 1997. View at: Publisher Site | Google Scholar

Copyright © 2016 Fernando Bastida-González et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

1050 Views | 332 Downloads | 1 Citation
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.