BioMed Research International / 2016 / Article / Tab 2

Clinical Study

A Randomized, Double-Blind, Placebo-Controlled Trial: The Efficacy of Multispecies Probiotic Supplementation in Alleviating Symptoms of Irritable Bowel Syndrome Associated with Constipation

Table 2

List of primers used in this study.

ProbioticPrimer codeSequence ()DNA regionAmplified length (bp)

L. rhamnosusLraFCTAGCGGGTGCGACTTTGTT16S/23S IS123 bp
LraRCAGCGGTTATGCGATGCGAA

L. plantarumLpl2FCATTGGAACCGAACCAGTTG16S/23S IS203 bp
Lpl2RCGGTGTTCTCGGTTTCATTATG

B. animalis subsp. lactisAnimFGCACGGTTTTGTGGCTGGpre16S171 bp
AnimRGACCTGGGGGACACACTG

L. acidophilusLacid2FGGGCAAATCACGAACGAGTApre16S132 bp
Lacid2RCTTTGTTTTCGTTCGCTTCA

L. reuteriLreu2FGTTGACGAAAGAATGAAATCCApre16S118 bp
Lreu2RTCATGTCGTCAATCAGATGTCA

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.