Research Article
Analysis of the Complete Mitochondrial Genome Sequence of the Diploid Cotton Gossypium raimondii by Comparative Genomics Approaches
Table 6
Distribution of tandem repeats in G. raimondii mt genome.
| | Number | Size (bp) | Start | End | Repeat (bp) × copy number | Location |
| | 1 | 15 | 97957 | 97986 | TAAGTGAAATAAAAT (×2) | IGS (nad4-exon1, trnD-GUC) | | 2 | 21 | 147834 | 147875 | TAACAGAAGTTTCAAGAGAAC (×2) | IGS (nad7-exon5, ccmB) | | 3 | 36 | 235143 | 235214 | TCGGAAAAACAAATGCCATGAAGGACTTAGGAAAGA (×2) | IGS (nad2-exon5, rpl2) | | 4 | 26 | 280595 | 280646 | GATCGCCGTCAAAGACAGGATTCGAG (×2) | IGS (rps14, rps4) | | 5 | 15 | 549174 | 549203 | TAAGTGAAATAAAAT (×2) | IGS (nad4-exon1, trnD-GUC) | | 6 | 42 | 653201 | 653284 | CTTGGCTTTCCTTTTTGTCTTGACTCTATGCCTTCCAGCTGT (×2) | IGS (sdh3, atp4) |
|
|
IGS: intergenic spacers.
|
