Table 6: Distribution of tandem repeats in G. raimondii mt genome.

NumberSize (bp)StartEndRepeat (bp) × copy numberLocation

1159795797986TAAGTGAAATAAAAT (×2)IGS (nad4-exon1, trnD-GUC)
221147834147875TAACAGAAGTTTCAAGAGAAC (×2)IGS (nad7-exon5, ccmB)
336235143235214TCGGAAAAACAAATGCCATGAAGGACTTAGGAAAGA (×2)IGS (nad2-exon5, rpl2)
426280595280646GATCGCCGTCAAAGACAGGATTCGAG (×2)IGS (rps14, rps4)
515549174549203TAAGTGAAATAAAAT (×2)IGS (nad4-exon1, trnD-GUC)
642653201653284CTTGGCTTTCCTTTTTGTCTTGACTCTATGCCTTCCAGCTGT (×2)IGS (sdh3, atp4)

IGS: intergenic spacers.