Table 1: Primer sequences for qRT-PCR.

Gene Sequence 5′-3′Size (bp) TmReference or gene accession number

G0S2F: gtcgccttacgtttggacttgc15658 [19]
R: caggtaactccgctcaggtgc
ATP4BF: cccctgcaggtggaatactt16058 NM_001001258.1
R: ggatcttgcacacgatgacc
GSTO1F: attacctcatctggccctgg15058 NM_214050.1
R: ctcgaaggtctctcggttca
CST3F: cgagtacaacaaagcgagca19360 NM_001044602.1
R: cagcgttttcttctgcaggt
FECHF: gatcgcgtttaccagtgacc18060 NM_001170523.1
R:cgctcattggactggatgtg
MX2F: aggcaaccaagagggaaatc13160 NM_001097416.1
R: cacactgatatgcccgatga
B2MF: ttcacaccgctccagtag16660 [20]
R: ccagatacatagcagttcagg
PPIAF: cacaaacggttcccagtttt17160 [21]
R: tgtccacagtcagcaatggt