BioMed Research International / 2016 / Article / Tab 1

Research Article

Combined Overlap Extension PCR Method for Improved Site Directed Mutagenesis

Table 1

List of primers used for COE-PCR showing restriction sites and base substitutions.

PrimerSequence ()Primer length (bp) (°C)Length of overlapping bases (bp)

FGSP1GAAGTCGCAACTAGTTTCTGACATGGAAAAC3160
RGSP1CGAAAAACCCCGGGAAAGGGAGG2361
FGSP2GCGGTTCCATGGGTCTAAGG2058
RGSP2GGATCCGATATCAGCCATGGTTTTT2558
FMP1GCTAAGGTGATtcGcCGTGTTATTCC266126
RMP1GGAATAACACGgCgaATCACCTTAGC2661
FMP2CCTATGGAGAAACTgATtATTTACCGCTTAAA3261.332
RMP2TTTAAGCGGTAAATaATcAGTTTCTCCATAGG3261.3
FMP3TTGCAATTACCCgATtGTCCAACAAATG2859.428
RMP3CATTTGTTGGACaATcGGGTAATTGCAA2859.4
FMP4CTTGTTGcGtGGGTTCA1745.217
RMP4TGAACCCaCgCAACAAG1745.2
FMP5TCACTGGcGtcGcTGGGCAG2046.520
RMP5CTGCCCAgCgaCgCCAGTGA2046.5
FMP6CATTGTCCTgGAGcGtCGcCTTAAACAA2841.928
RMP6TTGTTTAAGgCGaCgCTCcAGGACAATG2841.9
FMP7GAGTAATTTAcGcATGcGtcGcAGTGATCTTC32<4032
RMP7GAAGATCACTgCgaCgCATgCgTAAATTACTC32<40
FMP8GCCCCCTTCTAcATtagtTTtTATATGAAGTC324532
RMP8GACTTCATATAaAAactaATgTAGAAGGGGGC3245

Underlined are restriction sites. Substituted bases are bold and written in lowercase.