BioMed Research International

BioMed Research International / 2016 / Article

Research Article | Open Access

Volume 2016 |Article ID 9208035 | 6 pages | https://doi.org/10.1155/2016/9208035

Association of Complement Receptor 2 Gene Polymorphisms with Susceptibility to Osteonecrosis of the Femoral Head in Systemic Lupus Erythematosus

Academic Editor: Hai-Feng Pan
Received10 Mar 2016
Accepted06 Jun 2016
Published30 Jun 2016

Abstract

Osteonecrosis of the femoral head (ONFH) is a complex and multifactorial disease that is influenced by a number of genetic factors in addition to environmental factors. Some autoimmune disorders, including systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), and inflammatory bowel disease (IBD), are associated with the development of ONFH. Complement receptor type 2 (CR2) is membrane glycoprotein which binds C3 degradation products generated during complement activation. CR2 has many important functions in normal immunity and is assumed to play a role in the development of autoimmune disease. We investigated whether CR2 gene polymorphisms are associated with risk of ONFH in SLE patients. Eight polymorphisms in the CR2 gene were genotyped using TaqMan assays in 150 SLE patients and 50 ONFH in SLE patients (SLE_ONFH). The association analysis of genotyped SNPs and haplotypes was performed with ONFH. It was found that three SNPs, rs3813946 in 5′-UTR (untranslated region), rs311306 in intron 1, and rs17615 in exon 10 (nonsynonymous SNP; G/A, Ser639Asn) of the CR2 gene, were associated with an increased risk of ONFH under recessive model ( values; 0.004~0.016). Haplotypes were also associated with an increased risk (OR; 3.73~) of ONFH in SLE patients. These findings may provide evidences that CR2 contributes to human ONFH susceptibility in Korean SLE patients.

1. Introduction

Osteonecrosis of the femoral head (ONFH) is a complex and multifactorial disease which can be affected by combined genetic factors with relatively small effect in addition to environmental factors [1]. A variety of conditions, such as use of corticosteroids, alcohol abuse, and rheumatic diseases were reported as risk factors for secondary ONFH. Among autoimmune diseases, systemic lupus erythematosus (SLE) has shown higher incidence of ONFH ranging from 5 to 30%, than that of general population and ONFH, in turn, results in significant morbidity [2]. Although corticosteroid use has been reported as a significant predictive factor for developing ONFH in patients with SLE [3], there are also reports of patients with SLE complicated by ONFH, who have not taken corticosteroid [4, 5]. This implicates possible role of the disease progression itself or underlying genetics. Although some studies reported that immunologic factors including interleukins and tumor necrosis factors might develop ONFH [6, 7], most genetic studies have focused on gene polymorphisms affecting the coagulation and fibrinolytic systems [8, 9]. Moreover, few genetic studies were performed to reveal their roles in the development of SLE_ONFH [10].

Human complement receptor 2 (CR2) is encoded by a single gene containing 20 exons, which is located at chromosome 1q32.2 [11] and is expressed on mature B or follicular dendritic cells (FDCs) [12]. CR2 was known to bind C3 degradation products generated during the process of complement activation [13] and some studies suggested that CR2 might play an important role in immunity [14]. Therefore, given the pleiotropic effects of complement receptor, we investigated whether polymorphisms of the CR2 gene are associated with the susceptibility of SLE_ONFH.

2. Material and Methods

2.1. Patients and DNA

Blood samples and medical records were obtained from 150 SLE patients (13 males, 137 females; mean age, ) and 50 SLE_ONFH patients (4 males, 46 females; mean age, ). The SLE and SLE_ONFH patients were consecutively recruited from the Hanyang University Hospital for Rheumatic Diseases (Seoul, Korea). All SLE patients met the American College of Rheumatology (ACR) criteria for the classification of SLE [15]. Genomic DNA was isolated from the peripheral blood of each participant using a FlexiGene DNA Kit (QIAGEN, Valencia, CA). The current study was approved by the Institutional Review Board, and all participants in this study provided their informed consent.

2.2. Genotyping

Eight single nucleotide polymorphism (SNP) sites in the CR2 gene were selected based on locations, potential relevance to disease, and published data [11, 16, 17]. The genotype was determined using a TaqMan fluorogenic 5′-nuclease assay with predesigned or custom TaqMan primer/probe sets (Applied Biosystems, Foster City, CA). For genotyping of polymorphic sites, amplification primers and probes were designed for TaqMan assays (Applied Biosystems, Foster City, CA). The primer and probe sequences are indicated in Table 1. We designed both the PCR primers and the minor groove binder (MGB) TaqMan probes using Primer Express (Applied Biosystems). All reactions were performed following the manufacturer’s protocol. Details regarding the PCR reaction and TaqMan assay have been described previously [9]. The fluorescence data files from each plate were collected and analyzed using automated allele-calling software (SDS 2.2, Applied Biosystems).


TaqMan genotyping
SNP ID
Probes (ABI)Context sequence [VIC/FAM]

rs3813946 C_25599654_10CTCACAGCTGCTTGCTGCTCCAGCC[C/T]TGCCCTCCCAGAGCTGCCGGACGCT
rs311306C_1009912_10ACCTATCACCATCTAAAACCTTCTT[C/G]CTTATTTATGTACCTGTTTGTTGTT
rs1567190C_8827000_20GGAGTATAGGCTACATAGTGAGGAA[C/T]GGTAGTTGATTAAATGGATTGGAGC
rs17615C_12082973_1_TATAGTGGATTTACTTTGAAGGGCA[A/G]TAGTCAGATTCGTTGCAAAGCTGAT
rs17045328C_32843029_10ATTCTAACCTGAGAAATCTCTGATT[A/G]TAAAGTTGAGTATATTGTTTTTGTC
rs12032512C_26228419_10AACCTTAAGCTCAACTATGATTATT[C/G]AGGAATTCAGCATTTATGTCCAAGA
rs6690215C_30168452_10TTGGTGAGGATGCAAAGCAAATGGT[C/T]AATATTTGGGAGTTTTAATCAGGAA
rs17045468C_32842997_10GGGTCTCAAAAAAAATTAGGGATGT[C/T]ATTTGCAGGGCCTTCCTCATAGGAA

VIC: 2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein. VIC is a fluorescent dye that was originally developed by Applied Biosystems.
FAM: 6-carboxyfluorescein.
2.3. Statistical Analyses

The threshold of Hardy-Weinberg equilibrium (HWE) value is set at >0.05. Allelic or genotype association tests in the case-control were calculated using test or Fisher’s exact test. Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) for case-control data were also calculated. Genotypes were given codes of 0, 1, and 2; 0, 1, and 1; and 0, 0, and 1 in the codominant, dominant, and recessive models, respectively. The strength of linkage disequilibrium (LD) among the pairs of SNPs was evaluated using Haploview 4.2 software (http://www.broad.mit.edu/mpg/haploview/). Haploview software was also used to calculate haplotype structures and their frequencies within LD blocks. Haplotypes with frequencies < 5% were excluded from the following analysis. Continuous variables were compared by Student’s -test or ANOVA. All analyses were two-tailed, and values were considered to be statistically significant.

3. Results

3.1. Genetic Association of CR2 SNPs with SLE_ONFH Susceptibility

To determine whether CR2 gene polymorphisms might contribute to the susceptibility of ONFH development in SLE patients of Korea (SLE_ONFH), the sample of 150 SLE and 50 SLE_ONFH Korean patients was genotyped using eight SNPs spanning a 39 kb region of the CR2 gene from 0.6 kb upstream to 2.8 kb downstream of the gene (Figure 1). We selected 8 informative SNPs that included 1 regulatory SNP (rs3813946 in 5′-UTR; T/C), 1 exonic SNP (rs17615 in exon 10; G/A, Ser639Asn), and 6 haplotype-tagging intronic SNPs that tagged the two haplotype blocks (Figure 1(b)). The resulting SNP data including location, amino acid substitution, genotype, MAF, and HWE of all analyzed polymorphisms are demonstrated in Table 2. Table 3 shows a comparison of genotype frequencies between case-control groups. When genotype distributions between the SLE (control) and SLE_ONFH (case) groups were compared, the SNPs rs3813946 in 5′-UTR (untranslated region), rs311306 in intron 1, and rs17615 in exon 10 (nonsynonymous SNP; G/A, Ser639Asn) of the CR2 gene, located in block 1, demonstrated the evidence for association with risk of ONFH under recessive model ( values; 0.004~0.016). None of block 2 SNPs showed evidence for association (Table 3).


rs number
(alternative name)
PositionAmino acid substitution Genotype MAFHWE
C/CC/RR/RControlCase

rs3813946
(T/C)
Exon (5 UTR)NoTTCTCC0.1440.1840.309
rs311306
(G/C)
Intron 1NoGGCGCC0.1390.200.299
rs1567190
(T/C)
Intron 1NoTTCTCC0.4190.340.864
rs17615
(G/A)
Coding exon 10Ser639Asn (AGT-AAT)GGAGAA0.1330.1630.077
rs17045328
(A/G)
Intron 16NoAAAGGG0.2620.2080.517
rs12032512
(C/G)
Intron 17NoCCCGGG0.4190.450.396
rs6690215
(C/T)
Intron 18NoCCCTTT0.4630.430.618
rs17045468
(C/T)
Intron 18NoCCCTTT0.2550.230.379

MAF: minor allele frequency; HWE: values of deviation from Hardy-Weinberg equilibrium.
C/C: major homozygote; C/R: heterozygote; R/R: minor homozygote.

SNP rs numberGenotypeFrequencies (%) Allele Dominant Recessive
Controls (SLE)Cases (SLE_ONFH)OR (95% CI)OR (95% CI)OR (95% CI)

rs3813946TT102 (71.83)35 (71.43)
CT39 (27.46)10 (20.41)1.33 (0.73–2.45)0.3531.02 (0.50–2.10)0.95712.5 (1.37–115)
CC1 (0.7)4 (8.16)

rs311306GG108 (72.97)35 (70.0)
CG39 (26.35)10 (20.0)1.56 (0.86–2.81)0.1411.16 (0.57–2.34)0.68516.3 (1.86–143)
CC1 (0.68)5 (10.0)

rs1567190TT49 (33.11)22 (44.0)
CT74 (50.0)22 (44.0)0.72 (0.45–1.15)0.1640.63 (0.33–1.21)0.1650.67 (0.26–1.74)0.411
CC25 (16.89)6 (12.0)

rs17615 (S639N)GG108 (73.47)36 (73.47)
AG39 (26.53)10 (20.41)1.28 (0.68–2.40)0.4501.0 (0.48–2.08)1
AA0 (0)3 (6.12)

rs17045328AA78 (53.06)31 (64.58)
AG61 (41.5)14 (29.17)0.74 (0.43–1.29)0.2920.62 (0.32–1.22)0.1631.16 (0.30–4.55)
GG8 (5.44)3 (6.25)

rs12032512CC47 (31.76)16 (32.0)
CG78 (52.7)23 (46.0)1.14 (0.72–1.79)0.5870.99 (0.50–1.97)0.9751.53 (0.69–3.42)0.295
GG23 (15.54)11 (22.0)

rs6690215CC41 (27.7)20 (40.0)
CT77 (52.03)17 (34.0)0.88 (0.55–1.38)0.5690.58 (0.29–1.12)0.1031.38 (0.65–2.92)0.396
TT30 (20.27)13 (26.0)

rs17045468CC79 (53.74)30 (60.0)
CT61 (41.5)17 (34.0)0.87 (0.51–1.49)0.6160.78 (0.40–1.49)0.4421.28 (0.32–5.14)
TT7 (4.76)3 (6.0)

Genotype distributions are shown as number (%). Chi-square values and odds ratio (95% CI) are shown. OR: odds ratio; CI: confidence interval.
Fisher’s exact test.
3.2. Association of CR2 SNP Haplotypes with SLE_ONFH Susceptibility

Because LD is believed to be highly structured, with conserved blocks of sequence separated by hotspots of recombination, the function of a conserved haplotype may result from interaction between polymorphisms within a block. Therefore, SNP haplotypes were then constructed on the basis of genotypes of the SNPs, which resided in LD block (Figure 1(b)). Four major haplotypes with frequencies > 0.05 were predicted in LD block 1, and the frequency of each haplotype was compared between SLE and SLE_ONFH patients (Tables 4 and 5). Haplotype 3 (ht3: T-G-T-G-A) and haplotype 4 (ht4: C-C-T-A-A) were associated with an increased risk (OR; 3.73~) of ONFH in SLE patients under recessive analysis model (Table 4). None of haplotypes located in block 2 showed evidence for association (data not shown). These results suggest that polymorphisms located in extracellular domain of CR2 gene may be functionally involved with increased susceptibility to ONFH in SLE patients.


HaplotypeGenotypeFrequencies (%) Allele Dominant Recessive
SLESLE_ONFHOR (95% CI)OR (95% CI)OR (95% CI)

Block1-ht1
T-G-C-G-A
−/−46 (32.86)22 (45.83)
ht1/−71 (50.71)21 (43.75)0.66 (0.41–1.08)0.100.58 (0.30–1.13)0.1060.59 (0.21–1.65)0.313
ht1/ht123 (16.43)5 (10.42)

Block1-ht2
T-G-T-G-G
−/−74 (52.86)31 (64.58)
ht2/−58 (41.43)14 (29.17)0.73 (0.42–1.28)0.2750.62 (0.31–1.21)0.1581.1 (0.28–4.33)1.0
ht2/ht28 (5.71)3 (6.25)

Block1-ht3
T-G-T-G-A
−/−96 (68.57)28 (58.33)
ht3/−38 (27.14)13 (27.08)1.8 (1.05–3.09)0.0311.56 (0.79–3.06)0.1963.81 (1.21–12.0)
ht3/ht36 (4.29)7 (14.58)

Block1-ht4
C-C-T-A-A
−/−101 (72.14)35 (72.92)
ht4/−39 (27.86)10 (20.83)1.24 (0.66–2.33)0.5120.96 (0.46–2.01)0.918
ht4/ht40 (0.0)3 (6.25)

(i) SNP order of haplotypes: rs3813946 (T/C)-rs311306 (G/C)-rs1567190 (T/C)-rs17615 (G/A)-rs17045328 (A/G).
(ii) Haplotype distributions are shown as number (%). Chi-square values and odds ratio (95% CI) are shown. OR: odds ratio; CI: confidence interval.
(iii) Fisher’s exact test.

Haplotype IDHaplotypesFrequencies

Block 1ht1TGCGA0.407
ht2TGTGG0.255
ht3TGTGA0.196
ht4CCTAA0.142

Block 2ht1TC0.449
ht2CC0.287
ht3CT0.262

4. Discussion

Although ONFH is a common complication deteriorating the treatment of SLE, details of the pathogenesis are not well established. Because venous thrombosis and resultant blood flow obstruction mediated by thrombophilia or hypofibrinolysis are generally assumed to develop ONFH [18, 19], most of gene studies have focused on gene polymorphisms affecting the coagulation and fibrinolytic systems [8, 9]. Recent studies, however, reported that immunologic factors might develop ONFH [6, 7] and few genetic studies were performed to reveal their roles in the development of SLE_ONFH [10].

Complement receptor type 2 (CR2) is a membrane glycoprotein that binds C3 degradation products generated during complement activation, specifically iC3b, C3dg, and C3d. It has many important functions in normal immunity, such as targeting antigen to follicular dendritic cells in secondary lymphoid organs and cooperating with the B cell receptor to activate B cells [13]. CR2 is also assumed to play a role in the development of autoimmune disease [16]. Therefore, given these pleiotropic effects of complement receptor, we investigated whether polymorphisms of the CR2 gene were associated with the development of SLE_ONFH.

In this study, the SNPs rs3813946 in 5′-UTR, rs311306 in intron 1, and rs17615 in exon 10 (nonsynonymous SNP; G/A, Ser639Asn) of the CR2 gene are associated with the susceptibility of SLE_ONFH under recessive model. Haplotype T-G-T-G-A (ht3) and haplotype C-C-T-A-A (ht4) (SNP order of haplotypes: rs3813946-rs311306-rs1567190-rs17615-rs17045328) were also associated with an increased risk (OR; 3.73~) of SLE_ONFH (Table 4). However, when Bonferroni correction for multiple testing was applied, there was no significance in all SNPs and haplotypes. Previously, it was reported that the minor C allele of rs3813946, located in 5′UTR of CR2, reduced transcription of reporter genes in CR2-nonexpressing erythroleukemia cells [13] and CR2 expressing B cells [16]. Under basic conditions, primary B cells from individuals homozygous or heterozygous for the minor allele at rs3813946 demonstrated a trend toward reduced levels of CR2 RNA transcript [16]. Nonsynonymous SNP rs17615, which is located in exon 10 of the CR2 gene, might also have functional effects that could lead to disease. Exon 10 is located directly in 5′ of alternatively spliced exon 10a, which is found in a long CR2 isoform [20]. SNPs in coding region can change pre-mRNA splicing and message stability [21], and rs17615 allelic variant may regulate the relative level of the long and short isoform of CR2 [16]. Alternative splicing can be involved in the process of regulating normal physiological functions as well as pathologies. Genomewide alternative splicing studies estimate that greater than 95% of human multiexon genes express multiple splice isoforms. Interindividual variation in isoforms resulting from SNPs located in splicing regulatory motifs can occur in up to 21% of alternatively spliced genes [22], and the effects of these on splicing efficiency are assumed to contribute significantly to disease severity as well as susceptibility [23]. Alterations of CR2 expression have variable different effects on manifestations of disease in animal models of autoimmunity [24]. In addition, the substitution of asparagine for serine (rs17615; Ser639Asn), which is conserved in mice, rats, and sheep, may be important in receptor function. Therefore, there is a possibility that the dysregulation expression of CR2 is associated with the occurrence of the SLE_ONFH. Although the current study showed positive relationship between CR2 polymorphisms and SLE_ONFH, it is also limited. First, we had limited basic and clinical data of study samples. Important information such as family history of ONFH, onset of diseases, and medication history was not available in this study. Second, our study sample size is not enough for analysis of the effect of CR2 gene in ONFH with SLE. Although ONFH is one of the most common diseases around the hip joint in Korea, the incidence is relatively low in most countries. According to medical claims data from Korean National Health Insurance Corporation, the estimated average number of annual prevalent cases was 28.9 per 100,000. Moreover, the incidence of ONFH in SLE patients is very low. We did not get enough samples for obtaining high power in the association analysis. Nevertheless, we believe that our findings are valuable because this is first study to reveal the association between polymorphisms of the CR2 gene and susceptibility of SLE_ONFH. This study will promote the replication study of other researchers on the suggestive results and thus will improve our understanding of ONFH pathogenesis in SLE patients.

In conclusion, three CR2 polymorphisms are associated with ONFH susceptibility in SLE patients in our case-control study and these findings may provide evidence that CR2 contributes to human ONFH susceptibility in SLE patients. However, further well-designed studies with large sample size are mandatory for establishing our findings and reveal clinical importance of them.

Competing Interests

The authors do not have any competing interests.

Acknowledgments

This work was supported by Biomedical Research Institute grant, Kyungpook National University Hospital (2015).

References

  1. Y. Assouline-Dayan, C. Chang, A. Greenspan, Y. Shoenfeld, and M. E. Gershwin, “Pathogenesis and natural history of osteonecrosis,” Seminars in Arthritis and Rheumatism, vol. 32, no. 2, pp. 94–124, 2002. View at: Publisher Site | Google Scholar
  2. M. Abeles, J. D. Urman, and N. F. Rothfield, “Aseptic necrosis of bone in systemic lupus erythematosus. Relationship to corticosteroid therapy,” Archives of Internal Medicine, vol. 138, no. 5, pp. 750–754, 1978. View at: Publisher Site | Google Scholar
  3. M. A. Mont, C. J. Glueck, I. H. Pacheco, P. Wang, D. S. Hungerford, and M. Petri, “Risk factors for osteonecrosis in systemic lupus erythematosus,” Journal of Rheumatology, vol. 24, no. 4, pp. 654–662, 1997. View at: Google Scholar
  4. E. E. Velayos, J. D. Leidholt, C. J. Smyth, and R. Priest, “Arthropathy associated with steroid therapy,” Annals of Internal Medicine, vol. 64, no. 4, pp. 759–771, 1966. View at: Publisher Site | Google Scholar
  5. G. H. Leventhal and H. D. Dorfman, “Aseptic necrosis of bone in systemic lupus erythematosus,” Seminars in Arthritis and Rheumatism, vol. 4, no. 1, pp. 73–93, 1974. View at: Publisher Site | Google Scholar
  6. M. G. Tektonidou and H. M. Moutsopoulos, “Immunologic factors in the pathogenesis of osteonecrosis,” Orthopedic Clinics of North America, vol. 35, no. 3, pp. 259–263, 2004. View at: Publisher Site | Google Scholar
  7. M. N. Weitzmann and R. Pacifici, “The role of T lymphocytes in bone metabolism,” Immunological Reviews, vol. 208, pp. 154–168, 2005. View at: Publisher Site | Google Scholar
  8. J.-D. Chang, M. Hur, S.-S. Lee, J.-H. Yoo, and K. M. Lee, “Genetic background of nontraumatic osteonecrosis of the femoral head in the Korean population,” Clinical Orthopaedics and Related Research, vol. 466, no. 5, pp. 1041–1046, 2008. View at: Publisher Site | Google Scholar
  9. T.-H. Kim, S.-H. Baek, J. O. Lim, S.-H. Lee, and S.-Y. Kim, “Genetic variation in the coagulation factor V gene and risk of femoral head osteonecrosis,” Molecular Medicine Reports, vol. 12, no. 3, pp. 4434–4440, 2015. View at: Publisher Site | Google Scholar
  10. H. S. Kim, S.-C. Bae, T.-H. Kim, and S.-Y. Kim, “Endothelial nitric oxide synthase gene polymorphisms and the risk of osteonecrosis of the femoral head in systemic lupus erythematosus,” International Orthopaedics, vol. 37, no. 11, pp. 2289–2296, 2013. View at: Publisher Site | Google Scholar
  11. K. B. Douglas, D. C. Windels, J. Zhao et al., “Complement receptor 2 polymorphisms associated with systemic lupus erythematosus modulate alternative splicing,” Genes and Immunity, vol. 10, no. 5, pp. 457–469, 2009. View at: Publisher Site | Google Scholar
  12. J. Zhao, B. M. Giles, R. L. Taylor et al., “Preferential association of a functional variant in complement receptor 2 with antibodies to double-stranded DNA,” Annals of the Rheumatic Diseases, vol. 75, no. 1, pp. 242–252, 2016. View at: Publisher Site | Google Scholar
  13. M. N. Cruickshank, M. Karimi, R. L. Mason et al., “Transcriptional effects of a lupus-associated polymorphism in the 5' untranslated region (UTR) of human complement receptor 2 (CR2/CD21),” Molecular Immunology, vol. 52, no. 3-4, pp. 165–173, 2012. View at: Publisher Site | Google Scholar
  14. V. M. Holers, “Complement receptors and the shaping of the natural antibody repertoire,” Springer Seminars in Immunopathology, vol. 26, no. 4, pp. 405–423, 2005. View at: Publisher Site | Google Scholar
  15. M. C. Hochberg, “Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus,” Arthritis and Rheumatism, vol. 40, no. 9, p. 1725, 1997. View at: Google Scholar
  16. H. Wu, S. A. Boackle, P. Hanvivadhanakul et al., “Association of a common complement receptor 2 haplotype with increased risk of systemic lupus erythematosus,” Proceedings of the National Academy of Sciences of the United States of America, vol. 104, no. 10, pp. 3961–3966, 2007. View at: Publisher Site | Google Scholar
  17. H. Miyagawa, M. Yamai, D. Sakaguchi et al., “Association of polymorphisms in complement component C3 gene with susceptibility to systemic lupus erythematosus,” Rheumatology, vol. 47, no. 2, pp. 158–164, 2008. View at: Publisher Site | Google Scholar
  18. L. C. Jones, M. A. Mont, T. B. Le et al., “Procoagulants and osteonecrosis,” The Journal of Rheumatology, vol. 30, no. 4, pp. 783–791, 2003. View at: Google Scholar
  19. M. A. Kerachian, E. J. Harvey, D. Cournoyer, T. Y. K. Chow, and C. Séguin, “Avascular necrosis of the femoral head: vascular hypotheses,” Endothelium, vol. 13, no. 4, pp. 237–244, 2006. View at: Publisher Site | Google Scholar
  20. Y.-J. Liu, J. Xu, O. de Bouteiller et al., “Follicular dendritic cells specifically express the long CR2/CD21 isoform,” Journal of Experimental Medicine, vol. 185, no. 1, pp. 165–170, 1997. View at: Publisher Site | Google Scholar
  21. L. E. Maquat, “Evidence that selenium deficiency results in the cytoplasmic decay of GPx1 mRNA dependent on pre-mRNA splicing proteins bound to the mRNA exon-exon junction,” BioFactors, vol. 14, no. 1–4, pp. 37–42, 2001. View at: Publisher Site | Google Scholar
  22. T. Kwan, D. Benovoy, C. Dias et al., “Genome-wide analysis of transcript isoform variation in humans,” Nature Genetics, vol. 40, no. 2, pp. 225–231, 2008. View at: Publisher Site | Google Scholar
  23. G.-S. Wang and T. A. Cooper, “Splicing in disease: disruption of the splicing code and the decoding machinery,” Nature Reviews Genetics, vol. 8, no. 10, pp. 749–761, 2007. View at: Publisher Site | Google Scholar
  24. C. J. Del Nagro, R. V. Kolla, and R. C. Rickert, “A critical role for complement C3d and the B cell coreceptor (CD19/CD21) complex in the initiation of inflammatory arthritis,” The Journal of Immunology, vol. 175, no. 8, pp. 5379–5389, 2005. View at: Publisher Site | Google Scholar

Copyright © 2016 Tae-Ho Kim et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

884 Views | 353 Downloads | 2 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.