BioMed Research International

BioMed Research International / 2017 / Article

Research Article | Open Access

Volume 2017 |Article ID 1274960 | 8 pages | https://doi.org/10.1155/2017/1274960

The Association of Chemokine Gene Polymorphisms with VKH and Behcet’s Disease in a Chinese Han Population

Academic Editor: Paolo Spagnolo
Received20 Jan 2017
Revised04 Apr 2017
Accepted12 Apr 2017
Published14 May 2017

Abstract

To investigate the association of chemokine gene polymorphisms and Behcet’s disease (BD) and Vogt Koyanagi Harada (VKH) disease in a Chinese Han population. A case-control study was performed. Three hundred and seventy-one BD patients, 371 VKH disease patients, and 605 healthy controls were recruited to determine genetic variants of 26 SNPs in 12 chemokine genes with iPLEX Gold genotyping assay and Sequenom MassARRAY or TaqMan SNP assays. In this study, values showed a weak association of five SNPs of five genes in BD and three SNPs of three genes in VKH disease. However, after Bonferroni correction, the 26 investigated SNPs showed no significant differences in genetic variants, including genotype and allele frequencies, between BD or VKH disease patients and healthy individuals. Haplotype analysis for the chemokine genes showed a significant association with the TC haplotype of CXCL12 in VKH. Stratified gender analysis and genotype-phenotype analysis were conducted to analyze the association of the 26 SNPs of 12 chemokine genes with BD and VKH disease. However, no significant association was observed after Bonferroni correction. This study showed no association of 26 SNPs in 12 chemokine genes with both BD and VKH disease in a Chinese Han population.

1. Introduction

Uveitis is an intraocular inflammatory disease causing severe visual impairment worldwide [1]. In China, Behcet’s disease (BD) and Vogt-Koyanagi Harada (VKH) disease have the highest incidence in uveitis entities. BD is a chronic, relapsing, multisystemic inflammatory disorder, and its classical clinical characters include oral aphthae, genital ulcers, and recurrent iridocyclitis with hypopyon, which is probably due to an autoimmune response [2]. VKH disease is a multisystem autoimmune disease with a hallmark of diffuse granulomatous uveitis accompanied with poliosis, vitiligo, alopecia, and central nervous system abnormalities [3]. Various genes have been demonstrated to be relevant to different types of uveitis, comprising HLA-B27, HLA-A29, HLA-B51, HLA-DR4, IL-10, STAT4, STAT3, and UBAC2 [46] which suggested genetic factors are involved in the occurrence and development of uveitis.

Chemokines are a class of proinflammatory cytokines that are able to attract and activate the migration of circulating leukocytes under both physiological and pathological conditions [7]. According to the related structure and function, four subfamilies of human chemokines are classified: CC chemokines, CXC chemokines, CX3C family, and C family. Previous studies showed that chemokines are involved in various inflammatory and autoimmune diseases [8, 9]. Chemokines also contribute to the pathogenesis of uveitis, and previous researches showed that a higher chemokine production might be responsible for the more severe clinical manifestations in Behcet’s disease [10]. A comparison of Japanese VKH disease patients with controls indicated a dramatic decrease in the chemokine CSF-CCL2/MCP-1 [11].

Genetic variations of chemokine genes have been demonstrated responsible for the induction of chronic inflammation [7]. RANTES (CCL5) is associated with diabetes mellitus type 1 both genetically and functionally [12]. In the onset and development of childhood Idiopathic Thrombocytopenic Purpura, the polymorphism of SDF-1 (CXCL12) gene may be implicated [13]. Intron 1 of the CXCL9 gene (rs2276886) polymorphism may be closely related to pediatric Crohn’s disease [14]. Among Chinese Han individuals, genetic variations of CXCL12-3′G801A are involved in the pathogenesis of systemic lupus erythematosus [15]. Only few studies have analyzed the association of uveitis with chemokine gene polymorphisms. In Caucasian patients with HLA-B27 associated acute anterior uveitis, the CCL2-2518G allele was found significantly increased [16] and IL-8 (CXCL8) gene polymorphisms may affect susceptibility to BD in Turkey [17]. However, the association between other chemokine gene polymorphisms with uveitis is largely unknown and has been addressed recently by our group. Earlier we reported that CCL2 polymorphisms were protective for BD [18]. In this study, we expanded the amount of chemokines SNPs and also included VKH disease patients. The results show that none of the other chemokine genes polymorphisms showed an association with BD or VKH disease in the Chinese Han population.

2. Material and Methods

2.1. Study Population

Our study recruited 371 BD and 371 VKH disease patients and 605 healthy individuals which are all from Chinese Han population in the First Affiliated Hospital of Chongqing Medical University from January 2009 to April 2015 (Chongqing, China). According to race (Chinese Han) and geography, patients and the controls were matched. Diagnosis for BD and VKH disease followed the standard of the International Study Group for BD [19] and First International Workshop for VKH disease [20], respectively. The local research ethics committee approved the study and all the recruited individuals signed informed consent before donating blood samples. The Declaration of Helsinki adhered to the tenets.

2.2. Single Nucleotide Polymorphism (SNP) Selection

Screening of target chemokine gene SNPs was according to previously published studies which showed a positive association with other autoimmune and inflammatory diseases. Linkage disequilibrium (LD) data from the Han Chinese Hap Map database were taken into account. Twenty-seven SNPs of twelve genes with a minor allele frequency > 0.05 in Han Chinese were selected. These 27 SNPs in 12 chemokine genes, included 4 SNPs (rs1024610, rs1024611, rs13900, and rs4586) of CCL2 [21, 22], 5 SNPs (rs4251719, rs2306630, rs2107538, rs9355610, and rs2280788) of CCL5 [12, 23, 24], 1 SNP (rs854680) of CCL16 [25], 2 SNPs (rs223828 and rs223895) of CCL17 [2628], 3 SNPs (rs951005, rs2492358, and rs2812378) of CCL21 [2931], 1 SNP (rs4359426) of CCL22 [32], 2 SNPs (rs2302004 and rs2302005) of CCL24 [33], 3 SNPs (rs2227306, rs2227543, and rs4694178) of CXCL8 [34], 2 SNPs (rs2276886 and rs2869460) of CXCL9 [14, 35], 1 SNP (rs2869462) of CXCL10 [35], 2 SNPs (rs1801157 and rs2839693) of CXCL12 [13, 15], and 1 SNP (rs2277680) of CXCL16 [36]. We excluded rs1024611 of CCL2, since a study concerning this gene had been reported previously by our group [18].

2.3. DNA Extraction and Genotyping

Peripheral blood of the three experimental groups including BD and VKH disease patients and the controls was subjected to genomic DNA extraction with the QIAmp DNA Blood Mini Kit (Qiagen Inc., Valencia, CA, USA) and the DNA was stored at −80°C. The Applied Biosystems 7500 Real-Time PCR system was utilized to genotype CCL17/rs223828 (TagMan assay ID: C_30530263_10) by the TaqMan SNP Genotyping Assay (Applied Biosystems, Foster City, CA, USA). Genotype identification of the other 25 SNPs was conducted with the iPLEX Gold genotyping assay and Sequenom MassARRAY (Sequenom, CA, USA). Sequenom SNP Assay Design software version 3.0 was used to design primers of iPLEX reactions. Primer sequences used were shown in Table 1. The protocol and experimental requirements were performed strictly based on the instructions.


1st-PCRP2nd-PCRPUEP_SEQ

CCL2
 rs1024610ACGTTGGATGTTCTTCCTAGGCCATCTCACACGTTGGATGATTGAATGCGGTCCACCAAGCATGGTAAAGGATGCACTAAC
 rs13900ACGTTGGATGCTTAAGGCATAATGTTTCACACGTTGGATGCCCAAGAATCTGCAGCTAACGGCCATAGCTTTCCCCAGACACC
 rs4586ACGTTGGATGAGCTTCTTTGGGACACTTGCACGTTGGATGATGCAATCAATGCCCCAGTCCTCCCAGTCACCTGCTG
CCL5
 rs4251719ACGTTGGATGTCGTAGGTCCAGACACAAAGACGTTGGATGCTTGAGTGATAAAGTGCAGGAGTGATAAAGTGCAGGTGTTTTA
 rs2306630ACGTTGGATGTCTTTCTGGAACCTTGTGGGACGTTGGATGTGTGCCTCAATTGATCCCTGAAGCTGAAAAACAAGGTTCTCT
 rs2107538ACGTTGGATGACTGTATATCCAGAGGACCCACGTTGGATGTGAGTCTTCAAAGTTCCTGCCTGCTTATTCATTACAGATCTTA
 rs9355610ACGTTGGATGAGGTTAGCACACCAGTAGAGACGTTGGATGAATGCACCAGAACGCAAAGCTGGCTCAGAATACTAGAAATTAG
 rs2280788ACGTTGGATGCTTATGATACCGGCCAATGCACGTTGGATGCTCAGGCTGGCCCTTTATAGGCCCTTTATAGGGCCAGTT
CCL16
 rs854680ACGTTGGATGAAGTCAAACGGTCCAGCAACACGTTGGATGCCACATGATTGAGCTCACACGTGAGCTCACACTCTTTC
CCL17
 rs223895ACGTTGGATGCTGGTAATCACTGCCCAATGACGTTGGATGATCCTCAGCAATGTGGCTTCTTGGCTTCCAGCTCTG
CCL21
 rs951005ACGTTGGATGGCTCTTCTTGAGTTTGTGCGACGTTGGATGTGGGAAAGGGACCAACCATCCAAACCTATATAGGACCCACA
 rs2492358ACGTTGGATGGATCTGTTCAGTGTCAAGAGACGTTGGATGAGTCCGACATGCTTTTACTGTTTTACTGTAACTTGTCACTT
 rs2812378ACGTTGGATGCAGGCCCAGACATATTCAACACGTTGGATGCTGAAAGCTGGATTTGCTGGCCCCACTTATCTCAAACTAA
CCL22
 rs4359426ACGTTGGATGCTATGTCCCTTTGCAGACACACGTTGGATGAGTTGCTTGAAGCGCCACAGGGCAGTCTGTAGGCGA
 rs2302004ACGTTGGATGAACACCGCCAGTCCATTCACACGTTGGATGATCATCCCTACGGGTAAGACCGCTGGGGAAAGGG
 rs2302005ACGTTGGATGTGTTTGGTGCAGGGTTCAAGACGTTGGATGACAAAGAACATGCAGCAGGGCCTAGAAGAGGAGAGAGA
CXCL8
 rs2227306ACGTTGGATGCCCTTGACCTCAGTTAGTTCACGTTGGATGGGTATCACAGAGGATTATGCACTCTAACTCTTTATATAGGAAGT
 rs2227543ACGTTGGATGCCTGGGCAAACTATGTATGGACGTTGGATGATCGTCATTAGGTATCTGCCAGAAGCAATAGTGAGTTTGTTGTACT
 rs4694178ACGTTGGATGTTTCTGCCACAAAGACATCCACGTTGGATGCCTCTCAAGAACAAACTTGGTCTCAAGAACAAACTTGGAATTAA
CXCL9
 rs2276886ACGTTGGATGGTTCTGCCTGCATTGAAGAGACGTTGGATGGTGTTTGACTTGGCAGATCGTGAGAAGCTTTTATGACTGA
 rs2869460ACGTTGGATGCTGCCCGAATATTACACCTGACGTTGGATGAGCGTGGAGTCTCTAAGAAGGTTGTACACTTGATGTACACTTTA
CXCL10
 rs2869462ACGTTGGATGCACTGTTGTATTACTGAGACACGTTGGATGGAACATTTCCTTGTGTCTACTCTCATATTTCTAGCCTCTT
CXCL12
 rs1801157ACGTTGGATGAAGCCTAGTGAAGGCTTCTCACGTTGGATGTGCTGCCTCAGCTCAGGGTAACAGAAGAGGCAGACC
 rs2839693ACGTTGGATGCTCTGTTGCTCTCCATTCTCACGTTGGATGATCAGGAGCAAATACGCCAGAAGACAGGATGCTCTAGG
CXCL16
 rs2277680ACGTTGGATGGTGGGACCAGCATTTTTTTCACGTTGGATGCTCACTCGTCCCAATGAAACCCACAGTCTGGCAG

2.4. Statistical Analysis

Hardy-Weinberg equilibrium (HWE) analysis was carried out by the Chi-square () test in healthy samples while the genotype frequency was estimated by direct counting. No SNP significantly deviated from HWE (). Fisher’s exact test or test was applied to evaluate the differences in allele and genotype frequencies of all SNPs between patients and healthy controls using SPSS (version 17.0; SPSS Inc., Chicago, IL). The Bonferroni method was conducted to perform correction for multiple comparisons whereby the value was multiplied with the number of comparisons ( corrected ()). It was considered to be significant when . In those genes having more than one SNP we also performed a haplotype analysis. Haplotypes with a frequency of 0.03 or larger were included in the analysis [37, 38]. values for haplotypes were multiplied with the number of haplotypes in each gene. was considered as significant. Gene-gene interaction analysis was performed using MDR software (MDR 3.0.2 obtained from https://sourceforge.net/projects/mdr/).

3. Results

3.1. Clinical Features

The demographics and clinical symptoms of BD and VKH disease and demographics of controls are all showed in Table 2. The healthy cohort is comprised of 321 men and 284 women, who were on average years old. The BD patients consisted of 371 subjects (326 men and 45 women), years old on average. The VKH disease group contained 371 subjects (204 men and 167 women), and the patients were on average years old.


Clinical featuresTotal%

Patients with BD371
Mean age ± SD
Male32687.9
Female4512.1
Uveitis35896.5
Oral ulcer34994
Genital ulcer20856.1
Skin lesion27273.3
Arthritis5314.3
Pathergy reaction82.2
Patients with VKH disease371
Mean age ± SD
Male20455
Female16745
Sunset glow fundus18249
Headache15742.3
Tinnitus14639.4
Vitiligo12333.2
Alopecia13636.7
Gray hair5815.6
Controls605
Mean age ± SD
Male32153.1
Female28446.9

BD = Behcet’s disease, SD = standard deviation; VKH = Vogt-Koyanagi-Harada.
3.2. Chemokine Genotyping Results

Twenty-six SNPs covering 12 chemokine genes (CCL2, CCL5, CCL16, CCL17, CCL21, CCL22, CCL24, CXCL8, CXCL9, CXCL10, CXCL12, and CXCL16) were genotyped successfully and all SNPs of controls met the Hardy-Weinberg equilibrium. There was no significant difference in allelic and genotypic frequencies for all the 26 SNPs in the patients of BD or VKH disease compared with the controls (Supplemental Tables and in Supplementary Material available online at https://doi.org/10.1155/2017/1274960). However, values showed a weak association of five SNPs of five genes in BD and three SNPs of three genes in VKH disease (Tables 3 and 4). Compared with BD patients, the frequency of the CCL5/rs2107538 CC genotype (, OR = 1.309, and 95% CI = 1.002–1.710) was decreased and the CCL5/rs2107538 CT genotype frequency (, OR = 0.76, and 95% CI = 0.583–0.991) was increased in the controls. A higher frequency of CCL17/rs223828 C allele (, OR = 1.582, and 95% CI = 1.048–2.389) and a lower TT genotype frequency (, OR = 0.795, and 95% CI = 0.655–0.965) were found in the patients of BD. In CCL22/rs4359426, the frequency of the AA genotype (, OR = 3.071, and 95% CI = 1.227–7.685) was increased in BD patients. The CXCL10/rs2869462 showed an increased frequency of the CC genotype and C allele (, OR = 1.347, and 95% CI = 1.023–1.774; , OR = 1.313, and 95% CI = 1.081–1.595, resp.), and CXCL12/rs1801157 showed a decreased frequency of the CT genotype (, OR = 0.761, and 95% CI = 0.581–0.996) in BD patients. In VKH disease patients, there was an increased frequency of the CCL5/rs9355610 A allele (, OR = 0.805, and 95% CI = 0.662–0.979) and CXCL8/rs2227543 CT genotype (, OR = 0.72, and 95% CI = 0.552–0.940). In CXCL12/rs1801157, a weak association was detected in the C allele and CC and CT genotype in VKH disease (, OR = 1.327, and 95% CI = 1.069–1.647; , OR = 1.556, and 95% CI = 1.190–2.033; , OR = 0.627, and 95% CI = 0.476–0.826). However, after correction for multiple comparisons, all associations described above lost statistical significance.


GeneSNPBD (%)Controls (%) value valueOR95% CI

CCL5rs2107538Total sample368556
CC165 (0.448)213 (0.383)0.048NS1.3091.002–1.710
CT155 (0.421)272 (0.489)0.042NS0.7600.583–0.991
TT48 (0.130)71 (0.128)0.903NS1.0250.692–1.517
C485 (0.659)698 (0.628)0.170NS1.1460.943–1.393
T251 (0.341)414 (0.372)0.8730.718–1.060
CCL17rs223828 Total sample371604
CC155 (0.418)287 (0.575)0.081NS0.7930.611–1.029
CT167 (0.450)264 (0.437)0.690NS1.0540.813–1.368
TT49 (0.132)53 (0.088)0.028NS1.5821.048–2.389
C477 (0.643)838 (0.694)0.020NS0.7950.655–0.965
T265 (0.357)370 (0.306)
CCL22rs4359426Total sample365546
AA14 (0.038)7 (0.013)0.012NS3.0711.227–7.685
AC93 (0.255)134 (0.245)0.749NS1.0510.774–1.427
CC258 (0.707)405 (0.742)0.246NS0.8390.624–1.128
A121 (0.166)148 (0.136)0.075NS1.2670.976–1.645
C609 (0.834)944 (0.864)0.7890.608–1.024
CXCL10rs2869462Total sample360535
CC149 (0.414)184 (0.344)0.034NS1.3471.023–1.774
CG160 (0.444)243 (0.454)0.773NS0.9610.735–1.258
GG51 (0.142)108 (0.202)0.210NS0.6530.454–0.939
C458 (0.636)611 (0.571)0.006NS1.3131.081–1.595
G262 (0.364)459 (0.429)0.7610.627–0.925
CXCL12rs1801157Total sample371547
CC207 (0.558)271 (0.495)0.063NS1.2850.987–1.675
CT139 (0.375)241 (0.441)0.047NS0.7610.581–0.996
TT25 (0.067)35 (0.064)0.838NS1.0570.621–1.798
C553 (0.745)783 (0.716)0.163NS1.1620.941–1.435
T189 (0.255)311 (0.284)0.8600.697–1.063


GeneSNPVKH (%)Controls (%) value valueOR95% CI

CCL5rs9355610Total sample370555
AA97 (0.262)138 (0.249)0.644NS1.0740.794–1.451
AG188 (0.508)273 (0.492)0.629NS1.0670.820–1.388
GG85 (0.230)144 (0.259)0.305NS0.8510.626–1.158
A282 (0.516)549 (0.495)0.029NS0.8050.662–0.979
G358 (0.484)561 (0.505)1.2421.022–1.511
CXCL8rs2227543Total sample364552
CC146 (0.401)187 (0.339)0.055NS1.3070.994–1.719
CT155 (0.426)280 (0.507)0.016NS0.7200.552–0.940
TT63 (0.173)85 (0.154)0.442NS1.150.805–1.643
C447 (0.614)654 (0.592)0.355NS1.0950.904–1.326
T281 (0.386)450 (0.408)0.9140.754–1.106
CXCL12rs1801157Total sample368547
CC223 (0.605)271 (0.495)0.001NS1.5661.198–2.048
CT122 (0.331)241 (0.441)NS0.6370.478–0.829
TT23 (0.062)35 (0.064)0.928NS0.9750.566–1.679
C568 (0.771)783 (0.716)0.008NS1.3431.081–1.668
T168 (0.228)311 (0.284)0.7450.600–0.925

3.3. Haplotype Analysis

The haplotypes of chemokine genes (CCL2, CCL5, CCL17, CCL21, CCL24, CXCL8, CXCL9, and CXCL12) having more than one SNP were analyzed using the website http://analysis.bio-x.cn/myAnalysis.php. The haplotype TC of the CXCL12 gene including two SNPs (rs1801157 and rs2839693) showed a significant association with VKH (, , OR = 0.745, and 95% CI = 0.599–0.927) (Table 5) compared with healthy controls. The other tested haplotypes failed to show an association with either BD or VKH.


HaplotypeVKH (%) Control (%) value valueOR95% CI

CC466.03 (0.633)630.97 (0.590)2.8750.089NS1.1820.974–1.435
CT104.97 (0.143)135.03 (0.126)0.9160.338NS1.1430.869–1.504
TC164.97 (0.224)297.03 (0.278)6.9590.0080.0320.7450.599–0.927
TT0.03 (0.000)6.97 (0.007)

3.4. Stratified Analysis according to Gender and Main Clinical Manifestations of BD and VKH Disease

Stratified analyses were conducted to investigate whether the 26 SNPs have an association with gender and the primary clinical features in BD and VKH disease. BD in our population is more often seen in males and we therefore believe that a gender analysis might also be involved in the genetic predisposition to this disease and a previous study showed that chemokine gene SNPs of both CCL2 gene and CCL5 were more prevalent in males than females with BD [39]. To further confirm whether gender could influence genotype and allele frequencies in both diseases we performed the gender stratified study in these two diseases. We chose clinical manifestations with the frequency of approximately 50%. These included the presence of genital ulcers in BD and sunset glow fundus in VKH disease, respectively. Following Bonferroni correction, no association was observed after stratification by gender (Supplemental Tables and ). Also no significant differences were detected in these SNPs after stratifying VKH with sunset glow fundus or not. Additionally, no significant association was observed when BD was stratified by genital ulcer. MDR analysis was performed to test the gene-gene (epistatic effect) analysis interaction among 26 SNPs of 12 chemokine genes and this analysis showed that no gene-gene interaction existed in these two diseases. (Supplemental Tables and ).

4. Discussion

In the present study, we described the genotyping of 371 BD and 371 VKH patients and 605 controls from Chinese Han population for twenty-six SNPs in twelve chemokine genes. The AA genotype of MCP-1-2518 (rs1024611/CCL2) has been shown by our previous research to have a protective association with BD in the Chinese Han population [18]. Extension of this latter study with other chemokine polymorphisms and including another uveitis entity (VKH) did not reveal any new associations, although haplotype analysis did show that the haplotype TC of the CXCL12 gene including rs1801157 and rs2839693 shows a significant association with VKH.

Behcet’s disease, which is considered an autoinflammatory disorder, is characterized by posterior or generalized uveitis with a chronic nature and with recurrent episodes [2]. VKH disease is considered as a multisystem disorder caused by an autoimmune response against melanocyte associated antigens [3]. The attraction of leukocytes to tissues is an important feature of inflammation and is mediated by the local release of chemokines [40]. Genetic variation in the genes encoding these chemokines may affect their function and may be associated with disease predisposition. Several studies have reported investigations concerning the association of a limited number of chemokine genetic variations in patients with different uveitis entities [21, 39, 41], but a large scale analysis on chemokine gene associations with BD or VKH disease has not been reported.

Despite the fact that the 26 SNPs chosen for our study have been proved to be associated with several other immune-mediated diseases, we did not detect any significant association between these SNPs and the two uveitis entities, BD or VKH disease. An exception is the association of the haplotype TC of the CXCL12 gene including rs1801157 and rs2839693 with VKH, which suggests that CXCL12 polymorphisms might be a risk factor contributing to VKH disease in the Chinese population. Our study confirms earlier data presenting the absence of an association between the chemokine genes rs1024610/CCL2 and rs2280788/rs2107538/CCL5 with Behcet’s disease or retinal vasculitis in patients from UK [39]. Others showed that the frequency of the T allele of MCP-1 63555 (rs1024610/CCL2) was significantly associated with idiopathic anterior uveitis in Caucasian patients [21], which could not be shown in the uveitis entities we studied. This discrepancy may be due to differences in the uveitis entity studied or due to ethnic effects.

Selection of candidate SNPs is a crucial step for a gene variation study. In our study, 26 SNPs covering 12 chemokine genes (CCL2, CCL5, CCL16, CCL17, CCL21, CCL22, CCL24, CXCL8, CXCL9, CXCL10, CXCL12, and CXCL16) were selected on the basis of earlier association studies in autoimmune diseases, including type 1 diabetes [12], pediatric Crohn’s disease [14], and systemic lupus erythematosus [15]. It should be noted that composition and stratification of recruiting population may conclude to different results of an association study. To make sure that our data and results were valid, a series of efforts were made. First of all, the BD patients were diagnosed in strict accordance with the criteria of the International Study Group for BD while the VKH patients were diagnosed in strict accordance with the First International Workshop criteria of VKH disease. Any doubt or uncertainty in patient diagnosis is not allowed. Beyond that, to avoid ethnic bias, BD and VKH disease patients from other ethnic populations other than Chinese Han population were excluded.

Our study has several limitations. We only chose SNPs that have been previously reported to be related to autoimmune and inflammatory diseases, thus other unknown SNPs of chemokine genes with potential association with BD and VKH disease might be excluded. Furthermore, we studied only two common types of uveitis, with all the participants from Chinese Han population. Association of chemokine genes with other types of uveitis or different ethnic populations might also exist and awaits further investigation.

5. Conclusions

A large scale analysis of the role of chemokine genes only shows an association of CCL2 with BD but no effect on predisposition to VKH in Chinese Han population. The haplotype TC of the CXCL12 gene however did show a significant association with VKH compared with healthy controls.

Conflicts of Interest

The authors declare no conflicts of interest.

Acknowledgments

The authors would like to thank all donors enrolled in the present study. This work was supported by Natural Science Foundation Major International (Regional) Joint Research Project (81320108009), National Natural Science Foundation Project (31370893), Chongqing Key Laboratory of Ophthalmology (CSTC, 2008CA5003), National Key Clinical Specialties Construction Program of China, Key Project of Health Bureau of Chongqing (2012-1-003), Chongqing Science & Technology Platform and Base Construction Program (cstc2014pt-sy10002), and the Major Research Development Program of China (2016YFC0904000).

Supplementary Materials

Supplemental Table 1. Genotype and allele frequencies of chemokine genes polymorphism in BD and healthy cases. Supplemental Table 2. Genotype and allele frequencies of chemokine genes polymorphism in VKH syndrome and healthy cases. Supplemental Table 3. Genotype and allele frequencies of chemokine genes polymorphism in BD stratified by gender. Supplemental Table 4. Genotype and allele frequencies of chemokine genes polymorphism inVKH syndrome stratified by gender. Supplemental Table 5. The best model gene-gene interaction results in BD by MDR. Supplemental Table 6. The best model gene-gene interaction results in VKH by MDR.

  1. Supplementary Material

References

  1. A. Rothova, M. S. A. Suttorp-van Schulten, W. Frits Treffers, and A. Kijlstra, “Causes and frequency of blindness in patients with intraocular inflammatory disease,” The British Journal of Ophthalmology, vol. 80, no. 4, pp. 332–336, 1996. View at: Publisher Site | Google Scholar
  2. P. Yang, W. Fang, Q. Meng, Y. Ren, L. Xing, and A. Kijlstra, “Clinical features of Chinese patients with Behçet’s disease,” Ophthalmology, vol. 115, no. 2, pp. 312–318.e4, 2008. View at: Publisher Site | Google Scholar
  3. P. Yang, Y. Ren, W. Fang, B. Li, A. Kijlstra, and Q. Meng, “Clinical characteristics of Vogt-Koyanagi-Harada syndrome in Chinese patients,” Ophthalmology, vol. 114, no. 3, pp. 606–614, 2007. View at: Publisher Site | Google Scholar
  4. S. Hou, A. Kijlstra, and P. Yang, “Molecular genetic advances in uveitis,” Progress in Molecular Biology and Translational Science, vol. 134, pp. 283–298, 2015. View at: Publisher Site | Google Scholar
  5. L. Du, A. Kijlstra, and P. Yang, “Immune response genes in uveitis,” Ocular Immunology and Inflammation, vol. 17, no. 4, pp. 249–256, 2009. View at: Publisher Site | Google Scholar
  6. H. Yu, M. Zheng, L. Zhang et al., “Identification of susceptibility SNPs in IL10 and IL23R-IL12RB2 for Behçet's disease in Han Chinese,” Journal of Allergy and Clinical Immunology, 2016. View at: Publisher Site | Google Scholar
  7. J. Guergnon and C. Combadière, “Role of chemokines polymorphisms in diseases,” Immunology Letters, vol. 145, no. 1-2, pp. 15–22, 2012. View at: Publisher Site | Google Scholar
  8. I. F. Charo and R. M. Ransohoff, “The many roles of chemokines and chemokine receptors in inflammation,” The New England Journal of Medicine, vol. 354, no. 6, pp. 610–621, 2006. View at: Publisher Site | Google Scholar
  9. W. Cheng and G. Chen, “Chemokines and chemokine receptors in multiple sclerosis,” Mediators of Inflammation, vol. 2014, Article ID 659206, 8 pages, 2014. View at: Publisher Site | Google Scholar
  10. A. M. Abu El-Asrar, S. S. Al-Obeidan, D. Kangave et al., “CXC chemokine expression profiles in aqueous humor of patients with different clinical entities of endogenous uveitis,” Immunobiology, vol. 216, no. 9, pp. 1004–1009, 2011. View at: Publisher Site | Google Scholar
  11. I. Miyazawa, T. Abe, K. Narikawa et al., “Chemokine profile in the cerebrospinal fluid and serum of Vogt-Koyanagi-Harada disease,” Journal of Neuroimmunology, vol. 158, no. 1-2, pp. 240–244, 2005. View at: Publisher Site | Google Scholar
  12. A. Zhernakova, B. Z. Alizadeh, P. Eerligh et al., “Genetic variants of RANTES are associated with serum RANTES level and protection for type 1 diabetes,” Genes and Immunity, vol. 7, no. 7, pp. 544–549, 2006. View at: Publisher Site | Google Scholar
  13. F.-C. Ku, C.-R. Tsai, J.-D. Wang, C. H. Wang, T.-K. Chang, and W.-L. Hwang, “Stromal-derived factor-1 gene variations in pediatric patients with primary immune thrombocytopenia,” European Journal of Haematology, vol. 90, no. 1, pp. 25–30, 2013. View at: Publisher Site | Google Scholar
  14. M. Lacher, R. Kappler, S. Berkholz, H. Baurecht, D. von Schweinitz, and S. Koletzko, “Association of a CXCL9 polymorphism with pediatric Crohn's disease,” Biochemical and Biophysical Research Communications, vol. 363, no. 3, pp. 701–707, 2007. View at: Publisher Site | Google Scholar
  15. F.-X. Wu, X.-Y. Luo, L.-J. Wu et al., “Association of chemokine CXCL12-3′G801A polymorphism with systemic lupus erythematosus in a Han Chinese population,” Lupus, vol. 21, no. 6, pp. 604–610, 2012. View at: Publisher Site | Google Scholar
  16. B. J. Wegscheider, M. Weger, W. Renner et al., “Role of the CCL2/MCP-1 -2518A>G gene polymorphism in HLA-B27 associated uveitis,” Molecular Vision, vol. 11, pp. 896–900, 2005. View at: Google Scholar
  17. A. Atalay, S. Arikan, O. Ozturk et al., “The IL-8 gene polymorphisms in behçet's disease observed in denizli province of turkey,” Immunological Investigations, vol. 45, no. 4, pp. 298–311, 2016. View at: Publisher Site | Google Scholar
  18. S. Hou, P. Yang, L. Du et al., “Monocyte chemoattractant protein-1-2518 A/G single nucleotide polymorphism in Chinese Han patients with ocular Behçet's disease,” Human Immunology, vol. 71, no. 1, pp. 79–82, 2010. View at: Publisher Site | Google Scholar
  19. International Study Group for Behçet's Disease, “Criteria for diagnosis of Behçet's disease,” The Lancet, vol. 335, no. 8697, pp. 1078–1080, 1990. View at: Publisher Site | Google Scholar
  20. R. W. Read, G. N. Holland, N. A. Rao et al., “Revised diagnostic criteria for Vogt-Koyanagi-Harada disease: report of an international committee on nomenclature,” American Journal of Ophthalmology, vol. 131, no. 5, pp. 647–652, 2001. View at: Publisher Site | Google Scholar
  21. T. K. Yeo, M. A. Ahad, N.-W. Kuo et al., “Chemokine gene polymorphisms in idiopathic anterior uveitis,” Cytokine, vol. 35, no. 1-2, pp. 29–35, 2006. View at: Publisher Site | Google Scholar
  22. R. Cáliz, L. M. Canet, C. B. Lupiañez et al., “Gender-specific effects of genetic variants within Th1 and Th17 cell-mediated immune response genes on the risk of developing rheumatoid arthritis,” PLoS ONE, vol. 8, no. 8, Article ID e72732, 2013. View at: Publisher Site | Google Scholar
  23. X.-J. Chen, X.-H. Gong, N. Yan et al., “RNASET2 tag SNP but not CCR6 polymorphisms is associated with autoimmune thyroid diseases in the Chinese Han population,” BMC Medical Genetics, vol. 16, no. 1, article 11, 2015. View at: Publisher Site | Google Scholar
  24. Z.-K. Xie, H. Zhao, J. Huang, and Z.-F. Xie, “The regulated upon activation normal T-cell expressed and secreted (RANTES) −28C/G and −403G/A polymorphisms and asthma risk: a meta-analysis,” Molecular Diagnosis and Therapy, vol. 18, no. 5, pp. 523–531, 2014. View at: Publisher Site | Google Scholar
  25. T. Vyshkina, A. Sylvester, S. Sadiq, E. Bonilla, A. Perl, and B. Kalman, “CCL genes in multiple sclerosis and systemic lupus erythematosus,” Journal of Neuroimmunology, vol. 200, no. 1-2, pp. 145–152, 2008. View at: Publisher Site | Google Scholar
  26. S. A. Fisher, A. Moody, M. M. Mirza et al., “Genetic variation at the chromosome 16 chemokine gene cluster: development of a strategy for association studies in complex disease,” Annals of Human Genetics, vol. 67, no. 5, pp. 377–390, 2003. View at: Publisher Site | Google Scholar
  27. D. Galimberti, D. Scalabrini, C. Fenoglio et al., “Gender-specific influence of the chromosome 16 chemokine gene cluster on the susceptibility to Multiple Sclerosis,” Journal of the Neurological Sciences, vol. 267, no. 1-2, pp. 86–90, 2008. View at: Publisher Site | Google Scholar
  28. F. Liu, Y. Ding, and W. Yin, “Association of single nucleotide polymorphisms in TARC/CCL17 gene with Kawasaki disease and its clinical characteristics,” Zhongguo Dang Dai Er Ke Za Zhi, vol. 17, no. 7, pp. 668–671, 2015. View at: Google Scholar
  29. S. Raychaudhuri, E. F. Remmers, A. T. Lee et al., “Common variants at CD40 and other loci confer risk of rheumatoid arthritis,” Nature Genetics, vol. 40, no. 10, pp. 1216–1223, 2008. View at: Publisher Site | Google Scholar
  30. E. A. Stahl, S. Raychaudhuri, E. F. Remmers et al., “Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci,” Nature Genetics, vol. 42, no. 6, pp. 508–514, 2010. View at: Publisher Site | Google Scholar
  31. S. Chen, Q. Wang, C. Y. Wu et al., “A single-nucleotide polymorphism of CCL21 rs951005 T>C is associated with susceptibility of polymyositis and such patients with interstitial lung disease in a Chinese Han population,” Clinical and Experimental Rheumatology, vol. 33, no. 5, pp. 639–646, 2015. View at: Google Scholar
  32. T. Hirota, H. Saeki, K. Tomita et al., “Variants of C-C motif chemokine 22 (CCL22) are associated with susceptibility to atopic dermatitis: case-control studies,” PLoS ONE, vol. 6, no. 11, Article ID e26987, 2011. View at: Publisher Site | Google Scholar
  33. Y. R. Park, S. C. Choi, S. T. Lee, K. Kim, S. Chae, and H. Chung, “The association of eotaxin-2 and eotaxin-3 gene polymorphisms in a Korean population with ulcerative colitis,” Experimental & Molecular Medicine, vol. 37, no. 6, pp. 553–558, 2005. View at: Publisher Site | Google Scholar
  34. J.-S. Suh, W.-H. Hahn, and B.-S. Cho, “Polymorphisms of CXCL8 and its receptor CXCR2 contribute to the development and progression of childhood IgA nephropathy,” Journal of Interferon and Cytokine Research, vol. 31, no. 3, pp. 309–315, 2011. View at: Publisher Site | Google Scholar
  35. J. Zhang, E. Noguchi, O. Migita et al., “Association of a haplotype block spanning SDAD1 gene and CXC chemokine genes with allergic rhinitis,” Journal of Allergy and Clinical Immunology, vol. 115, no. 3, pp. 548–554, 2005. View at: Publisher Site | Google Scholar
  36. J. Seiderer, J. Dambacher, D. Leistner et al., “Genotype-phenotype analysis of the CXCL16 p.Ala181Val polymorphism in inflammatory bowel disease,” Clinical Immunology, vol. 127, no. 1, pp. 49–55, 2008. View at: Publisher Site | Google Scholar
  37. Y. Y. Shi and L. He, “SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci,” Cell Research, vol. 15, no. 2, pp. 97-98, 2005. View at: Publisher Site | Google Scholar
  38. Z. Li, Z. Zhang, Z. He et al., “A partition-ligation-combination-subdivision em algorithm for haplotype inference with multiallelic markers: update of the SHEsis (http://analysis.bio-x.cn),” Cell Research, vol. 19, no. 4, pp. 519–523, 2009. View at: Publisher Site | Google Scholar
  39. Y. Chen, R. W. Vaughan, E. Kondeatis et al., “Chemokine gene polymorphisms associate with gender in patients with uveitis,” Tissue Antigens, vol. 63, no. 1, pp. 41–45, 2004. View at: Publisher Site | Google Scholar
  40. A. D. Luster, “Mechanisms of disease: chemokines chemotactic cytokines that mediate inflammation,” The New England Journal of Medicine, vol. 338, no. 7, pp. 436–445, 1998. View at: Publisher Site | Google Scholar
  41. S.-K. Kim, W.-C. Jang, Y.-C. Ahn, S.-H. Lee, S.-S. Lee, and J.-W. Hur, “Promoter -2518 single nucleotide polymorphism of monocyte chemoattractant protein-1 is associated with clinical severity in Behçet's disease,” Inflammation Research, vol. 61, no. 6, pp. 541–545, 2012. View at: Publisher Site | Google Scholar

Copyright © 2017 Yang Huang et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1008 Views | 281 Downloads | 3 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.