BioMed Research International / 2017 / Article / Tab 1

Research Article

Circular RNA Profiling and Bioinformatic Modeling Identify Its Regulatory Role in Hepatic Steatosis

Table 1

Primers for qPCR.

GenePrimer sequence (5′-3′)Product length (nt)

hsa_circ_002082F: CCAGCTGAGTGATAAAGGCTGAR: TCGTTCTTCCGCTCAAATCCT158
hsa_circ_004183F: CGTCCATTCCACGAGGTTCTR: CCTCTGACGCAGGGTTTCC113
hsa_circ_000367F: CAATTGCACATTCCCTGCACTR: CGTATGGAATGGACCTGGACA114
hsa_circ_007850F: CAGAAAAGAAGGGGAAATTACAGR: TGTATGTGCAGGATCTCTGGG106
hsa_circ_004121F: CTTTGCTGGGAACATCAACAGAR: ACTGGGTCTGTCTTCATCGG112
hsa_circ_014724F: TCGAAATTAGCCGGACCCAGR: GATGATATCTGCAATAGTCTTGGC144
GAPDHF: TCAAGGCTGAGAACGGGAAGR: TGGACTCCACGACGTACTCA117

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.