Abstract
Arsenic (As) is a well-known toxic metalloid found naturally and released by different industries, especially in developing countries. Purple nonsulfur bacteria (PNSB) are known for wastewater treatment and plant growth promoting abilities. As-resistant PNSB were isolated from a fish pond. Based on As-resistance and plant growth promoting attributes, 2 isolates CS2 and SS5 were selected and identified as Rhodopseudomonas palustris and Rhodopseudomonas faecalis, respectively, through 16S rRNA gene sequencing. Maximum As(V) resistance shown by R. faecalis SS5 and R. palustris CS2 was up to 150 and 100 mM, respectively. R. palustris CS2 showed highest As(V) reduction up to 62.9% ( mM), while R. faecalis SS5 showed maximum As(III) oxidation up to 96% ( mM), respectively. Highest auxin production was observed by R. palustris CS2 and R. faecalis SS, up to and μg mL−1, respectively. Effects of these PNSB were tested on the growth of Vigna mungo plants. A statistically significant increase in growth was observed in plants inoculated with isolates compared to uninoculated plants, both in presence and in absence of As. R. palustris CS2 treated plants showed 17% ( cm) increase in shoot length and 21.7% ( cm) increase in root length, whereas R. faecalis SS5 treated plants showed 12.8% ( cm) increase in shoot length and 18.8% ( cm) increase in root length as compared to the control plants. In presence of As, R. palustris CS2 increased shoot length up to 26.3% ( cm), while root length increased up to 31.3% ( cm), whereas R. faecalis SS5 inoculated plants showed 25% (20.7 ± 1.4 cm) increase in shoot length and 33.3% (5.4 ± 0.65 cm) increase in root length as compared to the control plants. Bacteria with such diverse abilities could be ideal for plant growth promotion in As-contaminated sites.
1. Introduction
Arsenic (As) is a ubiquitous toxic metalloid which is also released from several industrial processes such as mining, tanning of hides, and combustion of coal. Due to these reasons, the level of As in drinking waters of many areas has been increased beyond WHO standard drinking water limits (0.01 mg L−1) [1]. As is primarily found in two major forms: arsenate [As(V)] and arsenite [As(III)] [2]. As(III) is reported to be ~100 times more toxic as compared to As(V) [3, 4]. As(V) causes harm to the cells by being analogous to phosphorous, replacing the latter in many chemical reactions [5]. As(III), on the other hand, affects activity of many enzymes by reacting with their sulfhydryl groups [6]. As is toxic to all life forms, including plants, animals, and human beings. Long-term exposure to As, especially through drinking water, can cause arsenicosis which is manifested as different types of cancers and skin allergies. In plants, the toxicity of As causes reduced growth and low yields [7]. As is toxic to microorganisms as well; however, several bacteria are known to resist and detoxify As. As-resistant bacteria are known to have effects on As-oxidation/reduction, methylation, and demethylation, as well as sorption and desorption as a result of their survival strategies against As-toxicity [8]. Such As-resistant bacteria are ideal for the bioremediation of As-contaminated lands. However, given the possible complexity and severity of the As-polluted sites, the bacteria should be metabolically diverse in order to thrive in different environments.
Purple nonsulfur bacteria (PNSB) are one of the most metabolically diverse and adaptable bacteria. They are phototrophic and are widely found in nature, especially in submerged habitats that are exposed to sunlight, such as rice paddies, sewage dumping sites, and riverbeds. These bacteria have an extensive range of growth modes and are capable of growing photoautotrophically/photoheterotrophically under anaerobic conditions in presence of incandescent light utilizing a variety of organic substrates and can also grow chemoorganotrophically under aerobic dark conditions [9]. These properties make them ideal for wastewater bioremediation [10]. Several strains of PNSB are also known to have plant growth promoting abilities in terms of nitrogen fixation [11], phosphate solubilization, and production of phytohormones such as indole-3-acetic acid and 5-aminolevulinic (ALA) [12]. The most common genera are Rhodobacter and Rhodopseudomonas, detected in 73% and 80% of the samples, respectively [13]. Some PNSB have also been reported to resist and detoxify several toxic compounds such as As [14]. Consequently, PNSB can also play a substantial role in As-biogeochemistry and bioremediation.
Isolation and characterization of metabolically diverse PNSB having abilities not only to detoxify As but also to support plant growth could be very useful for bioremediation purposes. This could help in reclamation of As-polluted sites for agriculture purposes.
2. Materials and Method
2.1. Sampling
Sampling was done from the fish pond near the University of the Punjab, Quaid-e-Azam campus, Lahore, Pakistan (31°29′55.4′′N 74°17′31.9′′E). Sampling location in the pond was so selected that it was shallow enough to allow penetration of sunlight and deep enough to have anoxic conditions, perfect for PNSB. Thus, 3-4 feet deep water and sediment samples were collected. Temperature and pH of the samples were recorded. As(V) and As(III) were purchased as Na2HAsO4·7H2O and NaAsO2, respectively. All the experiments were performed in triplicate.
2.2. Enrichment and Isolation of PNSB
Media suggested by Biebl and Pfennig [15] with slight modifications was used. The media contained freshly prepared basal medium (0.33 gm KH2PO4, 0.33 gm MgSO4·7H2O, 0.33 gm NaCl, 0.05 gm CaCl2·2H2O, 0.5 gm NH4Cl, 1.0 gm sodium succinate, and 0.02 gm yeast extract L−1) to which 0.5 mL FeSO4·7H2O (0.02%) and 1.0 mL trace salt solution (10.0 mg ZnSO4·7H2O, 3.0 mg MnSO4·4H2O, 30.0 mg H3BO3, 20.0 mg CoCl2·6H2O, 2.0 mg NiCl2·6H2O, 3.0 mg Na2MoO4 L−1) were added and autoclaved. After autoclaving, while still warm, 450 mL of media was aseptically poured in autoclaved 500 mL Schott bottles. Media were allowed to cool and 50 mL of each sample (10% inoculum, water plus sediment) was inoculated aseptically, leaving little headspace. Media were overlaid with mineral oil and incubated at 28°C in the presence of incandescent light. Once the enrichment, reddish maroon colored bloom, was achieved (~10 days incubation), samples were drawn aseptically, serially diluted, and plated on Pfennig agar media plates. Media supplemented with different carbon sources (sodium acetate, sodium citrate, maleic acid, sodium succinate, and sodium lactate) were also used to conclude which carbon source is more suitable for the growth of PNSB. Plates were incubated at 28°C for 5–7 days in anaerobic jars (Oxoid) containing anaerobic sachet (Merck) in incandescent light. After incubation, PNSB were purified by streak plate method and characterized. PNSB were then cultured on Pfennig agar media (succinate) containing 1.0 mM As(V). PNSB that were able to grow in presence of As(V) were selected for further studies.
2.3. Minimum Inhibitory Concentration (MIC) of As(V)
Pfennig media containing 50 mM, 100 mM, or 150 mM As(V) were prepared and dispensed in screw capped tubes followed by autoclaving. The media were inoculated with overnight cultures, overlaid with mineral oil, and incubated at 28°C in incandescent light for 6-7 days. Presence or absence of growth was recorded.
2.4. As-Oxidation/Reduction Assay
2.4.1. Qualitative Assay
Mineral medium [16], supplemented with 10 mM As(V) or 5 mM As(III), was inoculated with PNSB and incubated at 37°C for 48 hours. After incubation, 200 μL of each supernatant was taken in microtiter plate wells and mixed with 0.01 M 12 μL KMNO4. Color development was observed and recorded. A change from purple to yellowish brown color indicates As(V) reduction to As(III) [17].
2.4.2. Quantitative Assay
Overnight PNSB cultures were harvested and pellets were washed (twice) with and resuspended in normal saline. Cell suspensions were divided into two sets of tubes: one set was supplemented with 10.0 mM As(V) and the other set was supplemented with 5.0 mM As(III) followed by incubation at 37°C for 5 hours. Samples were drawn at the start and after incubation. Samples were centrifuged and supernatants were analyzed for estimation of As(V) oxidation/reduction as reported by Cummings et al. [18] with slight modifications. Standard curve was created using known concentrations of As(V) ranging from zero to 1000 mM As(V). 100 μL of sample was mixed with 100 μL of 24 mM HCl followed by immediate vortexing. 100 μL of the acidified sample was mixed with 900 μL of the coloring reagent followed by immediate vortexing. The samples were incubated at 78°C in a water bath for 20 minutes and kept on ice for 5 minutes. Samples were quantified at 865 nm using spectrophotometer (CECIL CE 7200).
2.5. Determination of Cross Metal Resistance
Selected isolates were tested for resistance against other metals. Media containing 1.0 mM Co(NO3)2·6H2O, ZnSO4·7H2O, NiCl2·6H2O, CdCl2·5H2O, K2CrO4, or CuSO4·5H2O each were prepared. The media flasks were inoculated with overnight broth cultures and incubated at 37°C for 72 hours. After completion of incubation, absence or presence of growth was recorded.
2.6. 16S rRNA Gene Sequencing and Phylogenetic Analysis
16S rRNA gene of selected PNSB was sequenced from Macrogen (Korea) using primers 518F (CCAGCAGCCGCGGTAATACG) and 800R (TACCAGGGTATCTAATCC). Base call quality was checked though FinchTV. Sequences were classified using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) and nearest homologues were downloaded. Multiple sequence alignment was done in ClustalW. Neighbour-Joining (NJ) phylogenetic tree [19] was made in MEGA 5.0 [20] with 100 bootstrap replicates [21] as an estimate of branch support.
2.7. Plant Growth Promoting Attributes of PNSB
2.7.1. Auxin Production
LB-broth supplemented with 500 mg mL−1 tryptophan was prepared and inoculated with overnight PNSB cultures followed by 7 days of incubation at 37°C on 150 rpm agitation. Following incubation, cultures were centrifuged and 100 μL supernatant was mixed with 200 μL Salkowski’s reagent (1.0 mL 0.05 M FeCl3, 50 mL 35% HClO4) [22] in microtiter plate followed by incubation in dark for 30 minutes. Appearance of pinkish color indicated auxin production. Absorbance was measured at 535 nm using Epoch BioTek plate reader.
2.7.2. Phosphate Solubilization
PNSB were streaked on Pikovskaya [23] media followed by incubation at 28°C for 7 days. Following incubation, plates were observed for the presence or absence of clear zones around PNSB colonies, an indication of phosphate solubilization.
2.7.3. Hydrogen Cyanide (HCN) Production
PNSB were swabbed on nutrient agar supplemented with glycine (4.4 gm L−1) and a filter paper soaked in 2.0% Na2CO3 solution (in 0.5% picric acid) was placed on the top of the agar surface [24, 25]. After incubation at 28°C for 4 days, development of orange to red color of the filter paper indicated the positive result for HCN production.
2.8. Plant-Microbe Interaction Experiments
PNSB were cultured in Pfennig broth media as described earlier. Cells were harvested and resuspended in autoclave water to achieve optical density. Vigna mungo seeds, purchased from Punjab Seed Corporation, were surface-sterilized with 0.1% HgCl2 for 2.0 minutes with continuous shaking followed by washing with distilled water, 3-4 times. Seeds were incubated in separate as well as in mixed PNSB suspensions (consortium) for 15–20 minutes at room temperature. Following incubation, seeds were sown in 16 cm wide and 13.5 cm deep pots each containing equal amount of sieved soil. Eight seeds were sown per pot and after germination plants were thinned to five plants per pot. Pots were divided into 4 sets: (a) pots containing uninoculated seeds, (b) pots containing inoculated seeds, (c) pots containing uninoculated seeds and As [1.0 mM As(V) and 0.1 mM As(III)], and (d) the pots containing inoculated seeds as well as As [1.0 mM As(V) and 0.1 mM As(III)]. Each set contained 10 pots. The pots were placed in 12-hour photoperiod at °C for two weeks. Watering was done regularly.
2.9. Statistical Analysis
Results were analyzed for statistical significance using analysis of variance (ANOVA), followed by post hoc analysis using two-tailed -tests () in order to compare different treatments with each other. The threshold of significance was also adjusted using Bonferroni correction. All the biostatistical analysis was done using Microsoft Excel 2013 data analysis toolkit.
3. Results
3.1. Isolation and Identification of As-Resistant PNSB
Purplish maroon colored bloom was achieved in the enrichment Schott bottles after incubation of 10 days at 28°C in incandescent light. Media containing sodium acetate and sodium lactate did not show any growth. Malic acid containing media gave ~10.8 × 106 CFU mL−1 and sodium succinate containing media gave ~7 × 107 CFU mL−1, whereas CFU mL−1 on sodium citrate containing media was 2 × 107 (Table 1). All the isolated PNSB were catalase and oxidase positive. All isolates were Gram-negative and nonspore former (Table 1).
16S rRNA sequence analysis of the PNSB showed that isolate CS2 showed maximum homology to Rhodopseudomonas palustris (99%), whereas isolate SS5 showed maximum homology to Rhodopseudomonas faecalis (99%), when aligned through nucleotide BLAST tool of NCBI. The results were confirmed by making NJ-phylogenetic tree. Isolate CS2 grouped with R. palustris, whereas isolate SS5 grouped with R. faecalis (Figure 1). The sequences were submitted in NCBI GenBank under the accession numbers KY098792 and KY098793 for R. palustris CS2 and R. faecalis SS5, respectively.
3.2. Heavy Metal Resistance
Maximum As(V) resistance was shown by R. faecalis SS5, up to 150 mM, whereas R. palustris CS2 resisted up to 100 mM As(V) (Figure 2). All the isolates were resistant to 1.0 mM Cr, Ni, and Zn, while they were sensitive to the Cu, Cd, and Co.
3.3. Estimation of As-Oxidation/Reduction
KMNO4 was used as reagent which changes its color to yellow in presence of As(III) but retains its color in the presence of As(V). R. palustris CS2 was found to be As(V) reducers, while R. faecalis SS5 was found to be As(III)-oxidizer (Table 1).
Isolates R. palustris CS2 showed highest As(V) reduction potential and reduced 62.9% ( mM) As(V) in 5 hours of incubation. Isolates CS4 and SS6 reduced 48% ( mM) As(V), whereas isolate SS6 reduced 42% ( mM) As(V). Maximum As(III) oxidation was exhibited by R. faecalis SS5 and oxidized 96% ( mM) As(III) in 5 hours of incubation (Figure 3).
3.4. Plant Growth Promoting Activities of PNSB
Isolate R. faecalis SS5 was strongly positive for the HCN production, while R. palustris CS2 was weakly positive as indicated by the intensity of the orange color developed on the filter paper (Table 1). All the isolates were positive for auxin production as well and maximum auxin production was exhibited by R. palustris CS2 ( μg mL−1) and R. faecalis SS5 ( μg mL−1) (Figure 4). All the isolates were negative for phosphate solubilization (Table 1).
3.5. Effects of PNSB on Plant Growth
Different sets of pots showed different germination rates according to the conditions provided. Germination rate was affected in the presence of As (data not shown).
Control plants were exposed neither to As nor to PNSB. Average shoot length was cm, while average root length was cm. Increase in shoot and root length was observed in the presence of PNSB. R. palustris CS2 treated plants showed 17% ( cm) increase in shoot length and 21.7% ( cm) increase in root length as compared to the control plants. R. faecalis SS5 treated plants showed 12.8% ( cm) increase in shoot length and 18.8% ( cm) increase in root length as compared to the control plants. Shoot length of the plants treated with mixed isolates (R. palustris CS2 and R. faecalis SS5) increased up to 15.4% ( cm), whereas root length increased up to 24.2% ( cm) as compared to the control plants (Figure 5).
Shoot and root lengths of plants exposed to As decreased up to 30.7% ( cm) and 29.7% ( cm), respectively. Plants exposed to both As(V) and PNSB showed increased root and shoot lengths. Shoot length of plants treated with As and R. palustris CS2 increased up to 26.3% ( cm), while root length increased up to 31.3% ( cm) as compared to the control plants (plants exposed to As). R. faecalis SS5 inoculated plants showed 25% ( cm) increase in shoot length and 33.3% ( cm) increase in root length in presence of As as compared to control plants. Shoot and root lengths of plants treated with mixed isolates in presence of As increased up to 33% ( cm) and 36.7% ( cm), respectively (Figure 6).
ANOVA of all the plant sets was significant, and Bonferroni corrected posttest -test indicated that the length of plants exposed to As was significantly lower and the length of plants exposed to PNSB was significantly higher, compared to control plants (not exposed to As) (). The statistical analysis also confirmed that the length of plants exposed to both As and PNSB was significantly higher as compared to plants exposed to As only ().
Wet and dry weight of plants exposed to neither As nor PNSB was .1 gm and .05 gm, respectively. R. palustris CS2 inoculated plants had .1 gm wet weight, while the dry weight was .03 gm. Wet weight of R. faecalis SS5 treated plants was .2 gm, whereas the dry weight was .04 gm.
Wet and dry weight of plants exposed to As was gm and gm, respectively. R. palustris CS2 treated plants had .8 gm wet weight in the presence of As, while the dry weight was gm. Wet weight of R. faecalis SS5 treated plants, in presence of As, was gm, whereas the dry weight was gm.
4. Discussion
Resistance against As(V) and plant growth promoting activities, such as auxin and HCN production, were the main parameters used for the screening and selection of PNSB. PNSB are known to utilize different carbon sources including those of TCA cycle, as well as different fatty acids and even fix CO2 for their growth [26, 27]. In the present study, As-resistant PNSB isolates were able to utilize malic acid, sodium succinate, or sodium citrate. The isolates showing best results were identified as R. palustris CS2 and R. faecalis SS5 by aligning their 16S rRNA gene sequences with the NCBI nucleotide database using BLAST tool. Rhodopseudomonas and many other PNSB belong toα-proteobacteria; however, some PNSB are also found inβ-proteobacteria [28]. Both qualitative and quantitative assays of As-oxidation/reduction showed that R. palustris CS2 had ability to reduce As(V) into As(III), whereas R. faecalis SS5 had the potential to oxidize As(III) to As(V). Genetic determinants of As-resistance and detoxification are found in the form of an operon called ars operon; thus the ability to resist and detoxify As is mostly linked together [29]. Bacteria are known to oxidize as well as reduce As, and even some bacteria are reported to perform both functions [30, 31]. Thus PNSB have important roles to play in the biogeochemical cycling of As as well.
Bacteria are also known to produce different phytohormones that enhance plants’ growth [32]. IAA, a type of auxin, exhibits one of the greatest plant growth promoting activity [33]. Both isolates R. palustris CS2 and R. faecalis SS5 showed highest level of auxin production. Hydrogen cyanide is another secondary metabolite important for plant growth. R. palustris CS2 and R. faecalis SS5 were also found to produce hydrogen cyanide. Plant growth promoting ability of these isolates was checked with V. mungo due to its fast growth rate. Both R. palustris CS2 and R. faecalis SS5 were able to enhance the growth of plants both in presence and in absence of As. The increase in the growth of plants due to PNSB in presence of As could be due to the reason that PNSB were able to oxidize/reduce As present in the soil, thus decreasing the bioavailability of As to the plants. Moreover, as these PNSB were also capable of producing phytohormones, this added extra benefit for the growth of the plants. Combined effect of R. palustris CS2 and R. faecalis SS5 was more pronounced for root enhancement. This could be due to the fact that mixed bacteria were able to oxidize As(III) as well as reduce As(V), keeping a redox cycle and thus further decreasing the bioavailability of As to the plants. Table S1 (see Supplementary Material available online at https://doi.org/10.1155/2017/6250327) shows some of the studies that report As-oxidation/reduction or plant growth promotion by PNSB. As the table indicates, many Rhodopseudomonas and Rhodobacter species are known to support plant growth by producing phytohormones. Nookongbut et al. [14] reported As-resistance and detoxification by different strains of R. palustris. Wong et al. [34] reported IAA production as well as plant growth enhancement by R. palustris. However, literature reporting both As-detoxification and plant growth promotion by same PNSB strains is scarce. The present study reports this important aspect of PNSB strains which can be utilized to enhance plant growth in As-contaminated areas.
5. Conclusions
Metabolically diverse bacteria such as PNSB with ability to not only detoxify As but also support plant growth could be useful both in bioremediation of As-contaminated lands and in supporting plant growth in such contaminated sites.
Competing Interests
The authors have no conflict of interests in these results.
Authors’ Contributions
Kanza Batool performed all the experiments and wrote the manuscript. Fatima tuz Zahra performed As-analysis. Yasir Rehman supervised the study and edited the manuscript.
Acknowledgments
University of the Punjab, Lahore, Pakistan, is acknowledged for providing funds to conduct this research.
Supplementary Materials
Table S1 shows some of the studies that reported either As-oxidation/reduction or plant growth promotion by PNSB. As the table indicates, many Rhodopseudomonas and Rhodobacter species are known to support plant growth by producing phytohormones. However, literature reporting both As-detoxification and plant growth promotion by same PNSB strains is scarce.