Research Article
Model Checking Temporal Logic Formulas Using Sticker Automata
Table 6
Checking for φ1: the encoding of FSA A1 of formula, encoding by the way of sticker automata, where sto() means WC.
| Object of code | Abbreviated transition rule | DNA code |
| Initial state | None | 3′ sto(I1 X0) 5′ = 3′ CGGTCTT 5′ | Acceptance state | None | 3′ sto(X3 I2) 5′ = 3′ CCGGCAG 5′ | Transition rule = | | 3′ sto() 5′ = 3′ AACGTTCCGTCGCTT 5′ | Transition rule = | | 3′ sto() 5′ = 3′ AACGTTCCGCGCCTTAAC 5′ | Transition rule = | | 3′ sto() 5′ = 3′ AACGTTCCGTCGCTTAACGTT 5′ | Transition rule = | | 3′ sto() 5′ = 3′ GTTCCGTCGCTTAAC 5′ | Transition rule = | | 3′ sto() 5′ = 3′ GTTCCGGGGCTTAACGTT 5′ |
|
|