Table 1: Primers for the Lsi1 gene used for screening via semiquantitative RT-PCR.

GeneForward primer (5′-3′)Reverse primer (5′-3′)Expected PCR product size

Lsi1 (I)CCAGGGCGAACTACTCCAACGAGCTTTGGTTGCTTGGTGGTTCG1066 bp
Lsi1 (II)ATGGCCAGCAACAACTCGTCACACTTGGATGTTCTC897 bp