Table 1: Primers for plasmid construction, qRT-PCR, and oligonucleotide.

Primer nameNucleotide sequence

Plasmid construction
 ADAM10XhoIF5′CCGCTCGAG CTGCAGCTTTTGCCTTGGTTCTTC 3′
 ADAM10NotIR5′ATAAGAATGCGGCCGC TTTTTGGGTGTTTTAAAAAGGTTTATTG 3′
 mutADAM10F5′CGTGTTCCCTGTTCTTCGTCAACAAATTTTCTTCACTTGCAGGCA 3′
 mutADAM10R5′TGCCTGCAAGTGAAGAAAATTTGTTGACGAAGAACAGGGAACACG 3′
qPCR
 ADAM10F5′CGTGTTCCCTGTTCTTCGTT 3′
 ADAM10R5′TAGCCTTGATTGGCAGTTGA 3′
 miR103aF5′AGCAGCAUUGUACAGGGCUAUGA3′
 miR107F5′AGCAGCAUUGUACAGGGCUAUCA3′
 snRNAU6F5′GCTTCGGCAGCACATATACTAAAAT3′
 snRNAU6R5′CGCTTCACGAATTTGCGTGTCAT3′
 GAPDHF5′TGACTTCAACAGCGACACCCA3′
 GAPDHR5′CACCCTGTTGCTGTAGCCAAA3′
 pri-miR-103a-1F5′TGCTCACCACTATACCACCAG3′
 pri-miR-103a-1R5′CAAAGAATCCCAACTATATGGTC3′
 pre-miR-103a-1F5′CCCTCGGCTTCTTTACAGTG3′
 pre-miR-103a-1R5′CAATGCCTTCATAGCCCTG3′