BioMed Research International

BioMed Research International / 2018 / Article

Research Article | Open Access

Volume 2018 |Article ID 4147932 | 9 pages | https://doi.org/10.1155/2018/4147932

Simvastatin Improves the Jaw Bone Microstructural Defect Induced by High Cholesterol Diet in Rats by Regulating Autophagic Flux

Academic Editor: Takashi Saku
Received18 Dec 2017
Accepted17 Apr 2018
Published27 Jun 2018

Abstract

Objective. The objective of this study is to evaluate the effect of simvastatin on the jaw bone microstructural defect and autophagy in rats with high cholesterol diet (HCD). Methods. Male Sprague-Dawley rats were fed a standard rodent chow (NC group) or a high cholesterol diet for 32 weeks and the HCD-fed rats were treated with vehicle (HC group) or simvastatin (5 mg/kg orally daily for 8 weeks, HC + SIM group, and /group). The static histomorphometric changes in the jaw bone tissues in individual rats were evaluated. The relative levels of OPG, RANKL, NF-κB, LC3, and p62 in the jaw bone tissues were determined by quantitative RT-PCR and/or immunohistochemistry. Results. Compared with the NC group, the HC groups had lower trabecular bone volume, trabecular thickness and trabecular number, and increased ratios of RANKL/OPG in the jaw bone, accompanied by enhanced NF-κB activation and autophagy. Simvastatin treatment inhabited these changes, including the decreased levels of serum proinflammatory cytokines and increased autophagy. Conclusion. Simvastatin treatment could inhibit the hyperlipidemia-induced jaw bone microstructural defect in rats by increasing autophagic flux.

1. Introduction

High fat or cholesterol diet can cause hyperlipidemia, which is associated with oxidative stress and inflammation, leading to osteoporosis, a high prevalent metabolic disorder in developed and developing countries [1]. Previous studies have shown that hyperlipidemia is associated inversely with the levels of bone mineral density (BMD) in the jaw [25]. Low BMD will affect the osseointegration, stability, and function of an implant [6]. However, some studies have revealed that high fat diet containing diacylglycerol mitigates high fat diet-induced bone metabolic dysfunction in mice and promotes peak bone mass in young rats [7, 8]. Therefore, the precise effect of high fat diet, particularly for high cholesterol diet (HCD), on the bone metabolism in the jaw remains controversial.

Autophagy is an intracellular process of degradation of cytoplasmic components in lysosomes to maintain cellular homeostasis. During the process of autophagy, many stimuli can induce the formation of autophagosomes, in which the microtubule-associated protein 1A light chain 3 (LC3-I) on the autophagosomal inner membrane converts to LC3-II by conjugating to phosphatidylethanolamine. The LC3-II can recruit p62/SQSTM1 promotes the degradation of cargo proteins [9]. Recent studies have reported that autophagy is crucial for the function and survival of osteoclasts, osteoblasts, and osteocytes, as well as chondrocytes [10, 11]. However, the role of autophagy in regulating the hyperlipidemia-induced jaw bone abnormality has not been clarified.

Statins are common drugs for the treatment of hyperlipidemia and can modulate lipid and bone metabolism, improving osteoporosis [1214]. Previous studies have shown that treatment with statin drug not only minimizes the risk of hyperlipidemia-related bone fracture but also increases osteoblastic activity [15, 16]. Actually, treatment with simvastatin can increase the osteogenesis and inhibit bone reabsorption in the parietal bone of rabbits [17]. It is notable that the jaw bone originates from the neural crest ectoblast mesenchyme with a distinct intramembranous ossification and has a better osteogenic differentiation ability [18, 19]. However, there is no information on whether and how treatment with simvastatin can modulate the hyperlipidemia-induced jaw bone microstructural defect.

In this study, we tested the hypothesis that treatment with simvastatin could mitigate hyperlipidemia-induced jaw bone microstructural defect by upregulating autophagy flux in rats.

2. Materials and Methods

2.1. Animals and Experimental Design

Male Sprague-Dawley rats at 6 weeks of age and weighing 170-190 g were obtained from Beijing Vital River Laboratory Animal Technology and housed in a specific pathogen-free facility at 22-25°C with a 12-hour light/dark cycle and free access to standard rodent chow and water. After one week of acclimatization, the rats were randomized into (1) normal control diet (the NC group, ) with 100% standard rodent chow; or (2) high cholesterol diet (HCD, ) with 2% cholesterol + rodent chow (Table 1, Beijing Vital River Laboratory Animal Technology) for 24 weeks. The NC group of rats continually received standard rodent chow. The HCD-fed rats were continually fed with HCD, randomized, and treated orally with vehicle as the HC group or with 5 mg/kg simvastatin by gavage daily for eight weeks as the HC + SIM group. During the experiment period, body weights of individual rats were measured using an automatic electronic balance (Shanghai Yousheng Weighing Apparatus, Shanghai, China) weekly. The experimental protocol was approved by the Animal Ethics Committee of Shandong Provincial Hospital.


Normal control dietHigh cholesterol diet

Protein (g/100g)2017
Carbohydrate (g/100g)5849
Fat (g/100g)621
Selenium (g/100g)1.4×10−51.6×10−5
Cholesterol (g/100g)02
Fatty acids (g/100g)
C14:00.020.02
C16:00.970.97
C16:10.020.02
C18:00.210.21
C18:11.231.23
C18:22.572.57
C18:30.170.17
Total saturated1.111.11
Total monounsaturated1.221.22
Total polyunsaturated2.932.93
Total kcal/g3.43.4

2.2. Serum Analysis

At thirty-two weeks after HCD feeding, the rats were food-fasted overnight and their peripheral blood samples were collected, followed by sacrifice. After coagulation of the collected blood samples, the blood samples were centrifuged for preparing serum samples. The levels of serum triglycerides (TG), total cholesterol (TC), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured using enzymatic methods in an AutoBiochemical Analyzer (AU5400; Olympus Corporation, Tokyo, Japan).

2.3. Bone Histology

After being sacrificed, the jaw bone tissue samples from individual rats were dissected out and fixed in 4% paraformaldehyde for 48 hours. After fixation, the jaw bone and tooth samples were decalcified in 10% EDTA solution (pH 7.2) for 2 weeks at room temperature. The decalcifying solution was changed with fresh one every 5 day. The samples were paraffin-embedded, and the longitudinal tissue sections (5 μm) were stained with hematoxylin and eosin (H&E). Three to five areas selected randomly from each sample were photoimaged under an Olympus microscope (BX51TRF; Tokyo, Japan) using the Image Pro Plus software, version 6.0 (Media Cybernetics, Rockville, MD, USA). The trabecular bone volume relative to the tissue volume (BV/TV, %), trabecular number (Tb.N, mm−1), trabecular thickness (Tb.Th, μm), and trabecular separation (Tb.Sp, μm) in each image were analyzed in a blinded manner.

2.4. Immunohistochemistry

The bone tissue sections were deparaffinized using xylene and rehydrated by serial concentrations of ethanol. After antigen retrieval using 0.125% pancreatin at 37°C for 30 min, the sections were treated with 3% H2O2 in methanol to inactivate endogenous peroxidase and were incubated with anti-NF-κB (1 : 200), anti-LC3 (1 : 100), and anti-p62 (1 : 200, Abcam, Cambridge, UK) at 4 °C overnight. After being washed, the sections were incubated; biotinylated secondary antibodies and the bound antibodies were detected with peroxidase-labeled streptavidin at 37 °C for 30 min. The stained signals in the sections were visualized using Diaminobenzidine (Zsgb-bio, Beijing, China) and the sections were counterstained with haematoxylin. The vehicle PBS was used as the negative control in every step.

The intensity of the IHC staining was evaluated semiquantitatively using Image Pro Plus software, as described previously [20, 21]. Six visual fields selected randomly from each section were photoimaged and the mean values (IOD sum/area sum) of the images (magnification, 400×) were designated as representative staining intensity of LC3-II, p62, and NF-κB to determine the relative expression levels. The images were analyzed by two specialized pathologists in a blinded manner.

2.5. Reverse Transcription and Quantitative PCR

The dissected jaw bone tissues were frozen in liquid nitrogen and powdered. Total RNA was extracted from each jaw bone sample using Trizol reagent (Ambion), according to the manufacturer's instruction. The RNA samples were reversely transcribed into cDNA using the PrimeScript™ RT reagent kit with gDNA Eraser (TakaRa, Japan), according to the manufacturer's instruction. The relative levels of target gene mRNA transcripts to the control GAPDH were analyzed by quantitative RT-PCR using the FastStart DNA Master SYBR Green I kit (TakaRa, Japan) and specific primers in a LightCycler system 480 (Roche). The sequences of primers for OPG, RANKL, NF-κB, LC3, p62, and GAPDH are shown in Table 2. The PCR reaction consisted of 25 μl of 1 × SYBR Premix Ex TaqII, 0.2 μmol/l each of primers, and 20 ng cDNA template. The amplifications were performed in duplicate at 95°C for 30 s and subjected to 40 cycles of 95° C for 5 s and 60°C for 30 s. The relative levels of each target gene mRNA transcripts to the GAPDH were analyzed using method [22] and expressed as relative value (fold change) to the levels in the NC group.


Primer5′-3′ sequences

GAPDHF:CCCTCTCTCTGCTCACTCTGCT
R: CTTACTGCCCTCCTGCTTGG
OPGF: TGTGGAATAGATGTCACCCTGTGC
R: CACAGAGGTCAATGTCTTGGATGATC
RANKLF: GCTTCTCAGGAGTTCCAGCTATGAT
R: CGTTGCTTAACGTCATGTTAGAGATCT
NF-κBF: GCTATAATCCTGGACTTCTG
R: GAGGAAGGCTGTGAACATGA
Lc3F: GAGTGGAAGATGTCCGGCTC
R: CCAGGAGGAAGAAGGCTTGG
p62F:GCTGCTCTCTTCAGGCTTACAG
R: CCTGCTTCACAGTAGACGAAAG

2.6. Statistical Analysis

Data are expressed as mean ± standard deviation (SD). The difference among groups was assessed by one-way analysis of variance (ANOVA) and post hoc Fisher's Least Significant Difference (LSD) test using the SPSS, version 17.0 (SPSS, Chicago, IL, USA). A value of < 0.05 was considered statistically significant.

3. Results

3.1. Treatment with Simvastatin Significantly Improves Hyperlipidemia in Rats Fed with HCD

To determine the effect of simvastatin on HCD-induced hyperlipidemia, SD rats were fed with HCD for 24 weeks, randomized, and treated orally with vehicle or simvastatin daily for 8 weeks. A group of rats received vehicle PBS as the NC controls. Their body weights were measured weekly in Figure 1. All groups of rats increased their body weights gradually and there was no statistical significance in the body weights among these groups of rats at any specific time points measured (P > 0.05, Figure 1(a)).

Analysis of serum lipids indicated that there was no significant difference in the levels of serum TG and HDL among these groups of rats. In comparison with that in the NC group, significantly higher levels of TC and LDL were detected in the HC group (P < 0.001). However, the levels of serum TC and LDL in the HC + SIM group were significantly lower than that in the HC group (P < 0.01) but remained significantly higher than that in the NC group (P < 0.01, Figure 1(b)). Hence, treatment with simvastatin did not change the body weights but significantly mitigated the HCD-induced hyperlipidemia in rats.

3.2. Treatment with Simvastatin Improves the Hyperlipidemia-Induced the Jaw Bone Microstructural Defect in Rats

Hyperlipidemia can induce oxidative stress, leading to the bone microstructural defect. Next, we examined the effect of simvastatin on the jaw bone microstructure in the HCD-fed rats by histology. The static histomorphometry revealed that the HCD-fed rats displayed significantly lower trabecular bone volume (BV/TV), trabecular thickness (Tb.Th), and trabecular number (Tb.N), with the trabecular separation (Tb.Sp) higher than the NC rats (P < 0.05, Table 3). In contrast, the BV/TV, Tb.Th, and Tb.N values in the HC + SIM group of rats were significantly higher than HC group (P < 0.05), while the Tb.Sp values were significantly lower than that of the HC group of rats (P < 0.05). More importantly, there was no significant difference in the values of these measures between the HC + SIM and NC groups of rats.


GroupBV/TV(%)Tb.Th (μm)Tb.N (mm−1)Tb.Sp (μm)

NC
HC
HC+SIM

Results are expression as mean ± SD of each group of rats ( per group). ; ; vs. the NC group. ; ; vs. the HC group.

Next, the relative levels of RANKL and OPG mRNA transcripts in the jaw bone tissues of individual rats were determined by quantitative RT-PCR and the ratios of RANKL to OPG mRNA transcripts in individual groups of rats were calculated (Figure 2). In comparison with the NC group, significantly higher ratios of RANKL to OPG mRNA transcripts were detected in the jaw bone tissues of the HC groups of rats . Treatment with simvastatin significantly decreased the ratios of RANKL to OPG mRNA transcripts in the HC + SIM group ( vs. the NC or HC, Figure 2). Collectively, treatment with simvastatin significantly mitigated the hyperlipidemia-induced jaw bone microstructural defect in rats.

3.3. Treatment with Simvastatin Inhibits Hyperlipidemia-Related Inflammation in the Jaw Bone of HCD-Fed Rats

Hyperlipidemia can induce systemic inflammation and increase the NF-κB signaling and TNF-α and IL-1β expression in animals. To understand the action of simvastatin, the relative levels of NF-κB mRNA transcripts in the jaw bone tissues of individual rats were determined by quantitative RT-PCR. In comparison with that in the NC group, significantly increased levels of NF-κB mRNA transcripts were detected in the HC group (P < 0.05, Figure 3(a)). Treatment with simvastatin significantly reduced the levels of NF-κB mRNA transcripts by 39.34% compared to those in the HC group (P < 0.05). Further immunohistochemistry revealed that the NF-κB was expressed in osteoblasts, inflammatory mononuclear infiltrates, bone-lining cells, and osteoclasts. The mean density of anti-NF-κB immunoreactivity in the bone tissues of the HC group was significantly higher than in the NC (P < 0.01) and HC + SIM groups (P < 0.05, Figures 3(b)3(e)). Therefore, treatment with simvastatin mitigated the hyperlipidemia-induced inflammation in the jaw bone tissues of rats.

3.4. Treatment with Simvastatin Increases the Hyperlipidemia-Induced Autophagic Flux in the Jaw Bone Tissues of Rats

Hypercholesterolemia can inhibit autophagy in the heart of rats [23]. Finally, we examined the effect of simvastatin on autophagic flux in the jaw bone tissues of HCD-fed rats by quantitative RT-PCR and immunohistochemistry. In comparison with that in the NC group, significantly higher levels of LC3 and p62 mRNA transcripts were detected in the jaw bone tissues of the HC group of rats (P < 0.01, P < 0.05, respectively, Figures 4(a) and 4(b)). However, the relative levels of p62 mRNA transcripts in the HC + SIM group were significantly lower than that in the HC group (P < 0.01). Immunohistochemistry revealed similar patterns of the levels of LC3 and p62 protein expression in the jaw bone tissues of the different groups of rats (Figures 4(c)4(h), Table 4). Thus, treatment with simvastatin increased the hyperlipidemia-induced autophagic flux in the jaw bone tissues of HCD-fed rats.


groupLC3IIp62

NC
HC
HC + SIM

Results are expressed as mean ± SD of each group. ; ; vs. the NC group. ; ; vs. the HC group.

4. Discussion

The present study employed a HCD-fed rat model to test the effect of simvastatin treatment on the jaw bone microstructural defect. We found that treatment with simvastatin not only improved the HCD-induced hyperlipidemia but also mitigated the HCD-induced jaw bone microstructural defects by reducing inflammation and increasing autophagic flux in the jaw bone of rats. To the best of our knowledge, this was the first study to show that autophagy regulated the jaw bone metabolism in rats fed with HCD.

Feeding with HCD or HFD can induce hyperlipidemia in animals. We found that rats fed with HCD for 32 weeks had significantly higher levels of serum TC and LDL to develop hyperlipidemia, consistent with a previous observation [24]. Treatment with simvastatin significantly decreased the levels of serum TC and LDL in rats. High levels of serum LDL are risk for bone tissue alterations [2527]. Indeed, hyperlipidemia increases the osteoclast numbers and reduces the alveolar bone density in rats [28]. We found that HCD-fed rats developed significantly lower trabecular bone volume, trabecular thickness, and trabecular number but higher trabecular separation, demonstrating the jaw bone microstructural defects. In contrast, treatment with simvastatin improved the hyperlipidemia-induced jaw bone microstructural defects in rats. Hence, long-term HCD may have an adverse effect on dental implant and denture restoration. It is well known that old people, particularly for those with age of >55 years, usually have deficient in osteogenesis but increased levels of lipogenesis, leading to a significant decrease in bone density and a potential failure of dental implants [29, 30]. Conceivably, treatment with simvastatin to reduce hyperlipidemia may benefit patients with dental implants, particularly those old people, by preventing/inhibiting the hyperlipidemia-induced bone microstructural defects.

It is well known that the balance of RANKL and OPG is crucial for regulating osteoclastogenesis and osteoblastogenesis, contributing to the bone metabolism and remodeling [31]. High-level RANKL produced by osteoblasts can bind to its receptor of RANK and stimulate osteoclast differentiation by activating the NF-κB signaling to induce c-Fos expression and NFATc1-triggered osteoclastogenic gene transcription, leading to osteoclastogenesis and bone resorption [3133]. OPG, a decoy receptor of RANKL, can bind to RANKL and prevent the RNAKL/RANK-mediated NF-κB activation to inhibit osteoclast differentiation but promote osteoblast differentiation in the bone. While hyperlipidemia can inhibit the proliferation and differentiation of osteoblasts and statins, such as simvastatin, it can stimulate osteoblast differentiation [3436]. Indeed, treatment with simvastatin can promote the bone formation and prevent bone loss in animals with inducible periodontitis by inhibiting inflammation [37]. In addition, simvastatin may stimulate OPG production [3840]. In this study, we found that HCD-related hyperlipidemia also enhanced the NF-κB expression in the jaw bone of rats, which was demolished by simvastatin treatment. Therefore, simvastatin treatment suppressed osteoclast differentiation and promoted osteoblast differentiation by down-regulating the RANKL/OPG ratio and NF-κB activation in rats.

A previous study has shown that chronic HFD feeding can decrease the levels of autophagy in mouse hypothalamus [41]. Inhibition of autophagy can reduce the expression of master regulators of lipid metabolism and enhance the NF-kB signaling and inflammatory response. The sterol regulatory element binding protein (SREBP-2), a transcription factor that regulates cholesterol metabolism, can activate autophagy [42]. A recent study indicates that genetic or pharmacological inhibition of autophagy suppresses mesenchymal stem cell differentiation into osteoblasts [43]. Similarly, autophagy appears to be crucial for ruffled border formation, secretion, and bone resorption of osteoclasts in vitro and in vivo [44, 45]. Ubiquitin binding proteins, such as p62, can regulate these ubiquitin-mediated processes and enhance the RANK-NF-κB signaling, which promotes osteoclastogenesis and osteoclast formation [46]. In this study, we found that HCD-fed increased the levels of LC3-II and p62 expression in the jaw bone of rats, consistent with other studies [4751]. Sabe et al. [51] thought that the high expression of LC3-II only could suggest either an increase in autophagy or a decrease in autophagy, because these proteins also accumulate in the environment of decreased autophagy. Furthermore, detection of the autophagy flux marker p62 can make more clear understanding of the alterations. The higher levels of p62 may stem from diminished autophagy due to the abnormality of autolysosomal degradation. More importantly, treatment with simvastatin prevented these changes and increased autophagy flux in the jaw bone of rats. These novel findings suggest that autophagy may regulate the jaw bone metabolism in HCD-fed rats.

5. Conclusion

In conclusion, the present study revealed that HCD feeding induced hyperlipidemia and decreased trabecular volume by increasing the RANKL/OPG ratios and activating the NF-κB signaling, which modulated autophagy in the jaw bone of rats. Simvastatin treatment improved the hyperlipidemia-induced jaw bone microstructural defects by increasing autophagy flux. Potentially, our findings may provide a significant contribution to further experimental and clinical studies by directly comparing the effects of simvastatin on the jaw bone with other bone tissues.

Ethical Approval

The study complied with ethical standards of Animal Ethics Committee of Shandong Provincial Hospital.

Conflicts of Interest

All the authors have no conflicts of interest.

Acknowledgments

The authors acknowledge Medjaden Bioscience Limited for assistance in preparing the manuscript. They also thank Professor Jiajun Zhao and Ling Gao (Shandong Provincial Hospital) for their invaluable contributions to this study. This study was supported by a grant from the National Natural Science Foundation of China (NSFC; Grant no. 81401211).

References

  1. C. C. Mandal, “High cholesterol deteriorates bone health: New insights into molecular mechanisms,” Frontiers in Endocrinology, vol. 6, article no. 165, 2015. View at: Publisher Site | Google Scholar
  2. J. Makovey, J. S. Chen, C. Hayward, F. M. K. Williams, and P. N. Sambrook, “Association between serum cholesterol and bone mineral density,” Bone, vol. 44, no. 2, pp. 208–213, 2009. View at: Publisher Site | Google Scholar
  3. K.-C. Kim, D.-H. Shin, S.-Y. Lee, J.-A. Im, and D.-C. Lee, “Relation between obesity and bone mineral density and vertebral fractures in Korean postmenopausal women,” Yonsei Medical Journal, vol. 51, no. 6, pp. 857–863, 2010. View at: Publisher Site | Google Scholar
  4. Y.-H. Kim, G.-E. Nam, K.-H. Cho et al., “Low bone mineral density is associated with dyslipidemia in South Korean men: The 2008-2010 Korean National Health and Nutrition Examination Survey,” Endocrine Journal, vol. 60, no. 10, pp. 1179–1189, 2013. View at: Publisher Site | Google Scholar
  5. T.-D. Jeong, W. Lee, S.-E. Choi et al., “Relationship between serum total cholesterol level and serum biochemical bone turnover markers in healthy pre- and postmenopausal women,” BioMed Research International, vol. 2014, Article ID 398397, 2014. View at: Publisher Site | Google Scholar
  6. Q. Zhou, D. Luo, T. Li et al., “Bone fracture in a rat femoral fracture model is associated with the activation of autophagy,” Experimental and Therapeutic Medicine, vol. 10, no. 5, pp. 1675–1680, 2015. View at: Publisher Site | Google Scholar
  7. H. S. Choi, S. J. Park, Z. H. Lee, and S.-K. Lim, “The effects of a high fat diet containing diacylglycerol on bone in C57BL/6J mice,” Yonsei Medical Journal, vol. 56, no. 4, pp. 951–960, 2015. View at: Publisher Site | Google Scholar
  8. P. Malvi, V. Piprode, B. Chaube et al., “High fat diet promotes achievement of peak bone mass in young rats,” Biochemical and Biophysical Research Communications, vol. 455, no. 1-2, pp. 133–138, 2014. View at: Publisher Site | Google Scholar
  9. V. Pierrefite-Carle, S. Santucci-Darmanin, V. Breuil, O. Camuzard, and G. F. Carle, “Autophagy in bone: self-eating to stay in balance,” Ageing Research Reviews, vol. 24, pp. 206–217, 2015. View at: Publisher Site | Google Scholar
  10. I. M. Shapiro, R. Layfield, M. Lotz, C. Settembre, and C. Whitehouse, “Boning up on autophagy :The role of autophagy in skeletal biology,” Autophagy, vol. 10, no. 1, pp. 7–19, 2014. View at: Publisher Site | Google Scholar
  11. M. R. Kaluđerović, M. Mojić, J. P. Schreckenbach, D. Maksimović-Ivanić, H.-L. Graf, and S. Mijatović, “A key role of autophagy in osteoblast differentiation on titanium-based dental implants,” Cells Tissues Organs, vol. 200, pp. 265–277, 2015. View at: Publisher Site | Google Scholar
  12. K. A. Chan, S. E. Andrade, M. Boles et al., “Inhibitors of hydroxymethylglutaryl-coenzyme A reductase and risk of fracture among older women,” The Lancet, vol. 355, no. 9222, pp. 2185–2188, 2000. View at: Publisher Site | Google Scholar
  13. S. Yaturu, “Skeletal effects of statins,” Endocrine Practice, vol. 9, no. 4, pp. 315–320, 2003. View at: Publisher Site | Google Scholar
  14. G. Lupattelli, A. M. Scarponi, G. Vaudo et al., “Simvastatin increases bone mineral density in hypercholesterolemic postmenopausal women,” Metabolism - Clinical and Experimental, vol. 53, no. 6, pp. 744–748, 2004. View at: Publisher Site | Google Scholar
  15. F. J. Maritz, M. M. Conradie, P. A. Hulley, R. Gopal, and S. Hough, “Effect of statins on bone mineral density and bone histomorphometry in rodents,” Arteriosclerosis, Thrombosis, and Vascular Biology, vol. 21, no. 10, pp. 1636–1641, 2001. View at: Publisher Site | Google Scholar
  16. S. Pauly, F. Luttosch, M. Morawski, N. P. Haas, G. Schmidmaier, and B. Wildemann, “Simvastatin locally applied from a biodegradable coating of osteosynthetic implants improves fracture healing comparable to BMP-2 application,” Bone, vol. 45, no. 3, pp. 505–511, 2009. View at: Publisher Site | Google Scholar
  17. R. W. K. Wong and A. B. M. Rabie, “Statin collagen grafts used to repair defects in the parietal bone of rabbits,” British Journal of Oral and Maxillofacial Surgery, vol. 41, no. 4, pp. 244–248, 2003. View at: Publisher Site | Google Scholar
  18. J. A. Helms and R. A. Schneider, “Cranial skeletal biology,” Nature, vol. 423, no. 6937, pp. 326–331, 2003. View at: Publisher Site | Google Scholar
  19. S. O. Akintoye, T. Lam, S. Shi, J. Brahim, M. T. Collins, and P. G. Robey, “Skeletal site-specific characterization of orofacial and iliac crest human bone marrow stromal cells in same individuals,” Bone, vol. 38, no. 6, pp. 758–768, 2006. View at: Publisher Site | Google Scholar
  20. L. L. Xavier, G. G. Viola, A. C. Ferraz et al., “A simple and fast densitometric method for the analysis of tyrosine hydroxylase immunoreactivity in the substantia nigra pars compacta and in the ventral tegmental area,” Brain Research Protocols, vol. 16, no. 1-3, pp. 58–64, 2005. View at: Publisher Site | Google Scholar
  21. C.-J. Wang, Z.-G. Zhou, A. Holmqvist et al., “Survivin expression quantified by image pro-plus compared with visual assessment,” Applied Immunohistochemistry & Molecular Morphology , vol. 17, no. 6, pp. 530–535, 2009. View at: Publisher Site | Google Scholar
  22. K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method,” Methods, vol. 25, no. 4, pp. 402–408, 2001. View at: Google Scholar
  23. Z. Giricz, G. Koncsos, T. Rajtík et al., “Hypercholesterolemia downregulates autophagy in the rat heart,” Lipids in Health and Disease, vol. 16, no. 1, article no. 60, 2017. View at: Publisher Site | Google Scholar
  24. F. Y. Kirzioǧlu, Ö. Fentoǧlu, M. T. Bulut et al., “Is a cholestrol-enriched diet a risk factor for alveolar bone loss?” Journal of Periodontology, vol. 87, no. 5, pp. 529–538, 2016. View at: Publisher Site | Google Scholar
  25. T. Yamaguchi, T. Sugimoto, S. Yano et al., “Plasma lipids and osteoporosis in postmenopausal women,” Endocrine Journal, vol. 49, no. 2, pp. 211–217, 2002. View at: Publisher Site | Google Scholar
  26. E. Luegmayr, H. Glantschnig, G. A. Wesolowski et al., “Osteoclast formation, survival and morphology are highly dependent on exogenous cholesterol/lipoproteins,” Cell Death & Differentiation, vol. 11, no. 1, pp. S108–S118, 2004. View at: Publisher Site | Google Scholar
  27. A. Alshehri, “Metabolic syndrome and cardiovascular risk,” Journal of Family and Community Medicine (JFCM), vol. 17, no. 2, p. 73, 2010. View at: Publisher Site | Google Scholar
  28. T. Sanbe, T. Tomofuji, D. Ekuni, T. Azuma, N. Tamaki, and T. Yamamoto, “Oral administration of vitamin C prevents alveolar bone resorption induced by high dietary cholesterol in rats,” Journal of Periodontology, vol. 78, no. 11, pp. 2165–2170, 2007. View at: Publisher Site | Google Scholar
  29. A. Keuroghlian, A. D. V. Barroso, G. Kirikian et al., “The effects of hyperlipidemia on implant osseointegration in the mouse femur,” Journal of Oral Implantology, vol. 41, no. 2, pp. e7–e11, 2015. View at: Publisher Site | Google Scholar
  30. J. N. M. Heersche, C. G. Bellows, and Y. Ishida, “The decrease in bone mass associated with aging and menopause,” Journal of Prosthetic Dentistry, vol. 79, no. 1, pp. 14–16, 1998. View at: Publisher Site | Google Scholar
  31. I. Silva and J. C. Branco, “Rank/Rankl/opg: literature review,” Acta Reumatólogica Portuguesa, vol. 36, no. 3, pp. 209–218, 2011. View at: Google Scholar
  32. B. F. Boyce and L. Xing, “Functions of RANKL/RANK/OPG in bone modeling and remodeling,” Archives of Biochemistry and Biophysics, vol. 473, no. 2, pp. 139–146, 2008. View at: Publisher Site | Google Scholar
  33. H. Ha, H. B. Kwak, S. W. Lee et al., “Reactive oxygen species mediate RANK signaling in osteoclasts,” Experimental Cell Research, vol. 301, no. 2, pp. 119–127, 2004. View at: Publisher Site | Google Scholar
  34. T. Maeda, A. Matsunuma, I. Kurahashi, T. Yanagawa, H. Yoshida, and N. Horiuchi, “Induction of osteoblast differentiation indices by statins in MC3T3-E1 cells,” Journal of Cellular Biochemistry, vol. 92, no. 3, pp. 458–471, 2004. View at: Publisher Site | Google Scholar
  35. G. Mundy, R. Garrett, S. Harris et al., “Stimulation of bone formation in vitro and in rodents by statins,” Science, vol. 286, no. 5446, pp. 1946–1949, 1999. View at: Publisher Site | Google Scholar
  36. T. Maeda, A. Matsunuma, T. Kawane, and N. Horiuchi, “Simvastatin promotes osteoblast differentiation and mineralization in MC3T3-E1 cells,” Biochemical and Biophysical Research Communications, vol. 280, no. 3, pp. 874–877, 2001. View at: Publisher Site | Google Scholar
  37. R. Dalcico, A. M. A. de Menezes, O. B. Deocleciano et al., “Protective mechanisms of simvastatin in experimental periodontal disease,” Journal of Periodontology, vol. 84, no. 8, pp. 1145–1157, 2013. View at: Publisher Site | Google Scholar
  38. S. Liu, K. Bertl, H. Sun, Z.-H. Liu, O. Andrukhov, and X. Rausch-Fan, “Effect of simvastatin on the osteogenetic behavior of alveolar osteoblasts and periodontal ligament cells,” Human Cell, vol. 25, no. 2, pp. 29–35, 2012. View at: Publisher Site | Google Scholar
  39. S. H. Stein, I. N. Dean, S. Y. Rawal, and D. A. Tipton, “Statins regulate interleukin-1β-induced RANKL and osteoprotegerin production by human gingival fibroblasts,” Journal of Periodontal Research, vol. 46, no. 4, pp. 483–490, 2011. View at: Publisher Site | Google Scholar
  40. H. Kaji, M. Kanatani, T. Sugimoto, and K. Chihara, “Statins Modulate the Levels of Osteoprotegerin/Receptor Activator of NFκB Ligand mRNA in Mouse Bone-cell Cultures,” Hormone and Metabolic Research, vol. 37, no. 10, pp. 589–592, 2005. View at: Publisher Site | Google Scholar
  41. S. Kaushik, J. A. Rodriguez-Navarro, E. Arias et al., “Autophagy in hypothalamic agrp neurons regulates food intake and energy balance,” Cell Metabolism, vol. 14, no. 2, pp. 173–183, 2011. View at: Publisher Site | Google Scholar
  42. Y.-K. Seo, T.-I. Jeon, H. K. Chong, J. Biesinger, X. Xie, and T. F. Osborne, “Genome-wide localization of SREBP-2 in hepatic chromatin predicts a role in autophagy,” Cell Metabolism, vol. 13, no. 4, pp. 367–375, 2011. View at: Publisher Site | Google Scholar
  43. A. Pantovic, A. Krstic, K. Janjetovic et al., “Coordinated time-dependent modulation of AMPK/Akt/mTOR signaling and autophagy controls osteogenic differentiation of human mesenchymal stem cells,” Bone, vol. 52, no. 1, pp. 524–531, 2013. View at: Publisher Site | Google Scholar
  44. C. J. DeSelm, B. C. Miller, W. Zou et al., “Autophagy proteins regulate the secretory component of osteoclastic bone resorption,” Developmental Cell, vol. 21, no. 5, pp. 966–974, 2011. View at: Publisher Site | Google Scholar
  45. M. Nollet, S. Santucci-Darmanin, V. Breuil et al., “Autophagy in osteoblasts is involved in mineralization and bone homeostasis,” Autophagy, vol. 10, no. 11, pp. 1965–1977, 2014. View at: Publisher Site | Google Scholar
  46. A. Goode and R. Layfield, “Recent advances in understanding the molecular basis of Paget disease of bone,” Journal of Clinical Pathology, vol. 63, no. 3, pp. 199–203, 2010. View at: Publisher Site | Google Scholar
  47. S. M. Jahania, D. Sengstock, P. Vaitkevicius et al., “Activation of the homeostatic intracellular repair response during cardiac surgery,” Journal of the American College of Surgeons, vol. 216, no. 4, pp. 719–729, 2013. View at: Publisher Site | Google Scholar
  48. D. J. Klionsky, F. C. Abdalla, and H. Abeliovich, “Guidelines for the use and interpretation of assays for monitoring autophagy,” Autophagy, vol. 8, no. 4, pp. 445–544, 2012. View at: Publisher Site | Google Scholar
  49. A. A. Sabe, N. Y. Elmadhun, R. S. Dalal, M. P. Robich, and F. W. Sellke, “Resveratrol regulates autophagy signaling in chronically ischemic myocardium,” The Journal of Thoracic and Cardiovascular Surgery, vol. 147, no. 2, pp. 792–799, 2014. View at: Publisher Site | Google Scholar
  50. G. Bjorkoy, T. Lamark, S. Pankiv, A. Overvatn, A. Brech, and T. Johansen, “Monitoring autophagic degradation of p62/SQSTM1,” Methods in Enzymology, vol. 452, pp. 181–197, 2009. View at: Publisher Site | Google Scholar
  51. A. A. Sabe, N. Y. Elmadhun, A. A. Sadek, L. M. Chu, C. Bianchi, and F. W. Sellke, “Differential effects of atorvastatin on autophagy in ischemic and nonischemic myocardium in Ossabaw swine with metabolic syndrome,” The Journal of Thoracic and Cardiovascular Surgery, vol. 148, no. 6, pp. 3172–3178, 2014. View at: Publisher Site | Google Scholar

Copyright © 2018 Jianhua Zhou et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

638 Views | 229 Downloads | 3 Citations
 PDF  Download Citation  Citation
 Download other formatsMore
 Order printed copiesOrder

Related articles

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.