BioMed Research International / 2019 / Article / Tab 1 / Research Article
Protective Effect of the MCP-1 Gene Haplotype against Schizophrenia Table 1 Primers, fragment patterns, and enzymes used for RFLP analysis.
Polymorphisms Primers (5′–3′) Amplicon sizes (bp) Restriction enzymes -2518A/G (rs1024611) F : GCTCCGGGCCCAGTATCTR : ACAGGGAAGGTGAAGGGTATGA182,54 236 PvuII 362C/G (rs2857656) F : CTAGGCTTCTATGATGCTACR : TCCATTCACTGCTGAGACCA201,110 311 Hpy188I CCL2I/D (rs3917887) F : GCTGATCTTCCCTGGTGCTGATR : CATTAAATCCCAGTGCTTCTGCCTAI:202 D:188 —
F: forward primer; R: reverse primer; I: insertion; D: deletion. In order to ratify the data generated by the PCR-RFPL method, we analyzed 25% of the samples randomly.