Research Article
Inhibition of the Nrf2-TrxR Axis Sensitizes the Drug-Resistant Chronic Myelogenous Leukemia Cell Line K562/G01 to Imatinib Treatments
| No. 1 forward strand | GCAGCAAACAAGAGATGGCAA | No. 1 reverse strand | TTGCCATCTCTTGTTTGCTGC | No. 2 forward strand | GCACCTTATATCTCGAAGTTT | No. 2 reverse strand | AAACTTCGAGATATAAGGTGC | No. 3 forward strand | CCGGCATTTCACTAAACACAA | No. 3 reverse strand | TTGTGTTTAGTGAAATGCCGG | No. 4 forward strand | CCCTGTTGATTTAGACGGTAT | No. 4 reverse strand | ATACCGTCTAAATCAACAGGG |
|
|
Note. No. 3 is the target sequence (from 5′ to 3′).
|