BioMed Research International / 2019 / Article / Tab 3

Research Article

Inhibition of the Nrf2-TrxR Axis Sensitizes the Drug-Resistant Chronic Myelogenous Leukemia Cell Line K562/G01 to Imatinib Treatments

Table 3

Primer sequences of each gene used for RT-qPCR (from 5′ to 3′).

GeneGenBank serial numberPrimer sequencesProduct (bp)

Nrf2NM_006164.3ForwardACAATGAGGTTTCTTCGGCTAC141
ReverseCGTCTAAATCAACAGGGGCTAC

TrxRNM_003330.2ForwardTATCAGGAGGGCAGACTTCAA153
ReverseGACCATCACCTTCTTGCCATA

GAPDHBC004109ForwardAGAAGGCTGGGGCTCATTTG258
ReverseAGGGGCCATCCACAGTCTTC