BioMed Research International / 2019 / Article / Tab 1

Research Article

Shenqi Fuzheng Injection (SFI) Enhances IFN-α Inhibitory Effect on Hepatocellular Carcinoma Cells by Reducing VEGF Expression: Validation by Gene Silencing Technique

Table 1

miRNA oligo sequences (with negative control).

oligoOligo sequences 5′ to 3′

200-FTGCTGTGAAGATGTACTCGATCTCATGTTTTGGCCACTGACTGACATGAGATCGTACATCTTCA

200-RCCTGTGAAGATGTACGATCTCATGTCAGTCAGTGGCCAAAACATGAGATCGAGTACATCTTCAC

Negative-FTGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT

Negative-RCCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTC

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.