BioMed Research International / 2020 / Article / Tab 1

Research Article

In Vitro Evaluation of Curcumin-Encapsulated Chitosan Nanoparticles against Feline Infectious Peritonitis Virus and Pharmacokinetics Study in Cats

Table 1

Primers sequences for GAPDH, IL-1β, IL-6, and TNFα mRNA detection.

GeneAmplicon size (bp)Sequence (5 to 3)Reference

GAPDH96F: AATTCCACGGCACAGTCAAGG[10]
R: CATTTGATGTTGGCGGGATC
IL-1β178F: CTGGTGCTGTCTGGCTCATA[10]
R: TTCCCGTCTTTCATCACACA
IL-6333F: TGCCTGACAAGAATCACTACT[44]
R: GAACTACAGCAATCTTAGATG
TNFα250F: TGGCCTGCAACTAATCAACC[10]
R: GTGTGGAAGGACATCCTTGG

F: forward; R: reverse.

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.