Research Article

Antimicrobial Resistance Phenotype of Staphylococcus aureus and Escherichia coli Isolates Obtained from Meat in the Formal and Informal Sectors in South Africa

Table 1

Primers used in PCR detection of S. aureus and E. coli.

GeneReference

NucPrimer sequence 5-3F: GCGATTGATGGTGATACGGTT[35]
R: AGCCAAGCCTTGAACGAACTAAAGC
Product size (bp)270
PCR conditionsInitial denaturation at 95°C for 5 min was followed by 37 cycles of amplification (denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 60 s) and ending with a final extension at 72°C for 10 min

uidAPrimer sequence 5-3F: AAAACGGCAAGAAAAAGCAG[35]
R: ACGCGTGGTTAACAGTCTTGCG
Product size (bp)147
PCR conditionsInitial denaturation at 94°C for 2 min followed by 25 cycles of denaturation at 94°C for 1 min, annealing at 58°C for 1 min, and extension at 72°C for 1 min and ended with a final extension at 72°C for 2 min. Holding was at 4°C