BioMed Research International

BioMed Research International / 2021 / Article

Research Article | Open Access

Volume 2021 |Article ID 7463867 | https://doi.org/10.1155/2021/7463867

Dan Li, Yan Huang, Gang Wang, "Circular RNA circPVT1 Contributes to Doxorubicin (DXR) Resistance of Osteosarcoma Cells by Regulating TRIAP1 via miR-137", BioMed Research International, vol. 2021, Article ID 7463867, 19 pages, 2021. https://doi.org/10.1155/2021/7463867

Circular RNA circPVT1 Contributes to Doxorubicin (DXR) Resistance of Osteosarcoma Cells by Regulating TRIAP1 via miR-137

Academic Editor: Feipeng Zhao
Received11 Aug 2020
Revised25 Aug 2020
Accepted13 Apr 2021
Published24 Apr 2021

Abstract

Background. Chemoresistance is a major obstacle to the treatment of osteosarcoma patients. Circular RNA (circRNA) circPVT1 has been reported to be related to the doxorubicin (DXR) resistance in osteosarcoma. This study is designed to explore the role and mechanism of circPVT1 in the DXR resistance of osteosarcoma. Methods. circPVT1, microRNA-137 (miR-137), and TP53-regulated inhibitor of apoptosis 1 (TRIAP1) levels were detected by real-time quantitative polymerase chain reaction (RT-qPCR). The protein levels of ATP-binding cassette, subfamily C, member 1 (ABCC1), multidrug resistance-associated protein 1 (MRP-1), cleaved- (c-) caspase-3, B-cell lymphoma-2 (Bcl-2), and TRIAP1 were examined by a western blot assay. Cell viability, proliferation, and apoptosis were detected by cell counting kit-8 (CCK-8), colony formation, and flow cytometry assays, severally. The binding relationship between miR-137 and circPVT1 or TRIAP1 was predicted by starbase 3.0 and then verified by dual-luciferase reporter and RNA Immunoprecipitation (RIP) assays. The biological role of circPVT1 in osteosarcoma tumor growth and drug resistance was examined by the xenograft tumor model in vivo. Results. circPVT1 and TRIAP1 were highly expressed, and miR-137 was decreased in DXR-resistant osteosarcoma tissues and cells. Moreover, circPVT1 knockdown could boost DXR sensitivity by inhibiting DXR-caused proliferation and DXR-induced apoptosis in DXR-resistant osteosarcoma cells in vitro. The mechanical analysis discovered that circPVT1 acted as a sponge of miR-137 to regulate TRIAP1 expression. circPVT1 silencing increased the drug sensitivity of osteosarcoma in vivo. Conclusion. circPVT1 boosted DXR resistance of osteosarcoma cells partly by regulating the miR-137/TRIAP1 axis, hinting a promising therapeutic target for the osteosarcoma treatment.

1. Introduction

Osteosarcoma, which occurs mainly in children and adolescents, is the most common malignant bone tumor [1, 2]. Despite substantial progress in detection and therapeutic methods, the prognosis of osteosarcoma patients remains poor [3, 4]. Notably, chemotherapy has been considered to improve survival and reduce symptoms of osteosarcoma, but treatment failure often occurs owing to intrinsic or acquired chemoresistance [5]. Hence, it is imperative to find the underlying molecular mechanism of chemoresistance in osteosarcoma.

As a novel class of noncoding RNAs, circular RNAs (circRNAs) are characterized by a covalently closed loop without 5 caps and 3 polyadenylated tail [6]. circRNAs are widely expressed in mammalian cells and have been reported to regulate gene expression at different levels [7]. An extensive body of research indicated that the dysregulation of circRNAs participated in the development and progression of diverse cancers, serving as oncogenes or tumor suppressors [8, 9]. Furthermore, circRNAs have been reported to be closely related to chemoresistance in a variety of cancers, including osteosarcoma. For example, Dong and Qu showed that circRNA circUBAP2 boosted the cisplatin resistance in osteosarcoma through regulating the miR-506-3p-mediated Wnt/β-catenin signaling pathway [10]. circPVT1, transcribed from the long noncoding RNA region with PVT1 locus on chromosome 8q24, has been confirmed to promote chemotherapy resistance in some cancers [11, 12]. Moreover, circPVT1 was presented to be increased in osteosarcoma and facilitated the doxorubicin (DXR) resistance of osteosarcoma cells [13, 14]. Unfortunately, the exact mechanism of circPVT1 in DXR resistance of osteosarcoma has not been fully clarified.

Small endogenous noncoding RNA, microRNAs (miRNAs), could take part in the regulation of gene expression at the posttranscriptional level [15]. Several reports have exhibited that the abnormal expression of miRNAs is associated with drug resistance in many types of cancer, including osteosarcoma [1618]. MicroRNA-137 (miR-137) displayed abnormally low expression in human cancers, such as lung cancer [19], hepatocellular carcinoma [20], and osteosarcoma [21]. Importantly, the relevant literature reported that miR-137 was decreased in DXR-resistant osteosarcoma cell lines, and the overexpression of miR-137 could weaken the DXR resistance of osteosarcoma cells [22], suggesting the pivotal role of miR-137 in DXR resistance in osteosarcoma.

TP53-regulated inhibitor of apoptosis 1 (TRIAP1), an apoptosis inhibitor, has been identified as a novel effector of drug resistance in various cancers [23]. For instance, the downregulation of TRIAP1 could enhance the cisplatin sensitivity in human ovarian cancer by activating the cytochrome c/Apaf-1/caspase-9 pathway [24]. Also, TRIAP1, as a target of miR-107, was connected with the regulation of taxol sensitivity of breast cancer [25]. In osteosarcoma cells, TRIAP1 was increased and participated in the epirubicin-mediated antiproliferation and proapoptosis [26]. However, the role of TRIAP1 in DXR resistance in osteosarcoma is still largely unknown.

Here, circPVT1 was upregulated in DXR-resistant osteosarcoma cells and contributed to the DXR resistance in osteosarcoma. Using the bioinformatic analysis, there was the latent binding between miR-137 and circPVT1 or TRIAP1. Thus, the purpose of this study was to prove the role of circPVT1 and to explore whether the involvement of circPVT1 on DXR resistance in osteosarcoma was regulated by the miR-137/TRIAP1 axis.

2. Materials and Methods

2.1. Clinical Samples and Cell Culture

Osteosarcoma tissue samples were collected from 52 patients diagnosed with osteosarcoma at The First Hospital of Jilin University, and 45 normal bone tissue samples were provided by the volunteers from The First Hospital of Jilin University. Then, 52 osteosarcoma patients were divided into the chemoresistant group () who showed <90% tumor necrosis after chemotherapy and the chemosensitive group () who presented ≥90% tumor necrosis after chemotherapy, in line with the previous description [27]. This research got approved by the Ethics Committee of The First Hospital of Jilin University, and written informed consent was provided by every participant.

The human fetal osteoblastic cell line (hFOB1.19), human osteosarcoma cell lines (KHOS and U2OS), and 293T cell line were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). Under the humidified air atmosphere containing 5% CO2 at 37°C, cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Carlsbad, CA, USA) with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). Besides, DXR-resistant osteosarcoma cells (KHOS/DXR and U2OS/DXR) were established as previously [28], and the established cells were kept in the conditioned medium with 1 μg/mL DXR (Sigma-Aldrich, St. Louis, MO, USA) to maintain their drug-resistant phenotype.

2.2. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

According to the standard protocol, total RNA from tissues and cells was first extracted by using the TRIzol reagent (Invitrogen). After quantification with NanoDrop (NanoDrop Technologies, Wilmington, WI, USA), the extracted RNAs were reverse-transcribed to the first-strand complementary DNA (cDNA) using the PrimeScript™ RT Master Mix (TaKaRa, Dalian, China). With the help of the Thermal Cycler CFX6 System (Bio-Rad, California, USA), RT-qPCR was carried out using an SYBR Green PCR Kit (TaKaRa). Then, the obtained data were calculated by the 2ΔΔCt method, normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH for circPVT1 and TRIAP1) and U6 (for miR-137). The primers are showed in Table 1.


NamesSequences (5-3)

circPVT1: forwardAGTCCGCTGTCACCTTGAAT
circPVT1: reverseTGGCACAACCACTGCTTTTA
miR-137: forwardATTGCTTAAGAATACGCGT
miR-137: reverseGAACATGTCTGCGTATCTC
TRIAP1: forwardAGGATTTCGCAAGTCCAGAA
TRIAP1: reverseGCTGATTCCACCCAAGTAT
U6: forwardCTCGCTTCGGCAGCACA
U6: reverseAACGCTTCACGAATTTGCGT
GAPDH: forwardGTGGACCTGACCTGCCGTCT
GAPDH: reverseGGAGGAGTGGGTGTCGCTGT

2.3. Western Blot Assay

In brief, RIPA buffer including a protease inhibitor (Beyotime, Nantong, China) was applied to harvest the protein lysates from tissues or cells, followed by quantification with the Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, Rockford, IL, USA). And then, protein samples (50 μg) were separated with a sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) system, which was further transferred onto nitrocellulose membranes (Millipore, New York, NY, USA). After blocking in 5% nonfat milk for 2 h, the membrane was incubated with primary antibodies against ATP-binding cassette, subfamily C, member 1 (ABCC1, 1 : 1000, ab170904, Abcam, Cambridge, MA, USA), multidrug resistance-associated protein 1 (MRP-1, 1 : 1000, ab9531, Abcam), cleaved- (c-) caspase-3 (1 : 1000, ab2302, Abcam), B-cell lymphoma-2 (Bcl-2, 1 : 1000, ab59348, Abcam), TRIAP1 (1 : 1000, ab225938, Abcam), and GAPDH (1 : 1000, ab9485, Abcam) at 4°C overnight. The next day, the membranes were probed with the corresponding secondary antibodies for 1 h, and the protein bands were detected according to the enhanced chemiluminescence reagent (ECL; GE Healthcare, Piscataway, NJ, USA).

2.4. Cell Transfection

In this assay, circPVT1 small interfering RNA (si-circ) and scrambled siRNA control (si-NC), miR-137 mimic, miR-137 inhibitor, and their negative controls (mimic NC and inhibitor NC) were obtained from RiboBio (Guangzhou, China). Moreover, the sequence of TRIAP1 was subcloned into pcDNA vector (Invitrogen) to obtain the pcDNA-TRIAP1 overexpression plasmid (oe-TRIAP1), and the pcDNA empty vector (Invitrogen) acted as the corresponding control (vector). Finally, all transfection of KHOS/DXR and U2OS/DXR cells was conducted referring to the instructions of the Lipofectamine 3000 reagent (Invitrogen).

2.5. Drug Resistance Assay

Generally, after 48 h of transfection in 96-well plates, KHOS/DXR and U2OS/DXR cells ( cells/well) were treated with different concentrations of DXR (0, 2, 4, 8, 16, 32, and 64 μg/mL) for 48 h. Then, 10 μL cell counting kit-8 (CCK-8, Dojindo, Kumamoto, Japan) solution was added into each well for 4 h, and the optical density was assessed with a microplate reader (TECAN M1000, Austria GmbH, Austria) at a wavelength of 450 nm. The relative survival curve was used to exhibit the concentration of DXR triggering 50% inhibition of growth (IC50).

2.6. Colony Formation Assay

In this assay, transfected KHOS/DXR and U2OS/DXR cells in 6-well plates were incubated with DXR (8 μg/mL) for two weeks, followed by discarding the medium. After washing with phosphate-buffered saline (PBS, Invitrogen), the numbers of colonies per well were fixed 4% for 30 min and stained with 0.1% crystal violet. At last, visible colonies were imaged and counted manually.

2.7. Cell Apoptosis Assay

Transfected KHOS/DXR and U2OS/DXR cells were treated with 8 μg/mL DXR for 48 h, followed by washing with PBS (Invitrogen). Then, the treated cells were stained with 5 μL of Annexin (V-fluorescein isothiocyanate) V-FITC/Propidium Iodide (PI) (Selleck, Shanghai, China). According to FACSan flow cytometry (BD Biosciences, San Jose, CA, USA), the stained cells were examined, followed by analysis with Cell Quest software (BD Biosciences, Franklin Lakes, NJ, USA).

2.8. Dual-Luciferase Reporter Assay

Using the starbase 3.0 software, the potential relationship between miR-137 and circPVT1 or TRIAP1 was predicted. Then, the dual-luciferase reporter assay was applied to verify the consequence in 293T cells. Briefly, the sequences of circPVT1 and TRIAP1 3-untranslated region (3UTR) harboring wild-type (wt) or mutant-type (mut) putative miR-137 binding sites were amplified and inserted into pmirGLO vector (Promega, Madison, Wisconsin, USA), namely, circPVT1 wt/mut and TRIAP1 3UTR wt/mut reporter vectors. And then, the constructed reporter vectors and miR-137 mimic or mimic NC were cotransfected into the 293T cells, following the operation manual of the Lipofectamine 3000 reagent (Invitrogen). After incubation for 48 h, a dual-luciferase reporter assay kit (Beckman Coulter, Fullerton, CA, USA) was employed to analyze the luciferase activities.

2.9. RNA Immunoprecipitation (RIP)

In this assay, the RIP assay was conducted using the Magna RIP RNA-binding protein immunoprecipitation kit (Millipore, Billerica, MA, USA). After treating with RIP lysis buffer, KHOS/DXR and U2OS/DXR cells were incubated with the magnetic beads conjugated with anti-Argonaute2 (Ago2) antibody or negative control IgG. After 6 h of incubation, the proteinase K was utilized to digest the samples, and coprecipitated RNA was segregated. The purified RNA was analyzed by using RT-qPCR.

2.10. Tumor Xenograft Assay

Our study got approved by the Animal Ethics Committee of The First Hospital of Jilin University. At first, circPVT1 knockdown stable lentiviral vector (lenti-short hairpin-circPVT1, termed as sh-circ) and the corresponding control (sh-NC) were provided by GeneChem (Shanghai, China). BALB/C nude mice (male, 3–4 weeks old, per group) were gained from Vital River Laboratory (Beijing, China). Then, KHOS/DXR cells () stably transfected with sh-circ or sh-NC were subcutaneously injected into the nude mice. At the indicated time points (7, 14, 21, 28, and 35 days), tumor volume was measured. At 35 days upon cell inoculation, the mice were sacrificed, and the tumors were excised and weighed.

2.11. Statistical Analysis

All data were analyzed with GraphPad Prism7 software. Pearson correlation analysis was used to analyze the expression association between miR-137 and circPVT1 or TRIAP1. Student’s -test or one-way analysis of variance (ANOVA) with Tukey’s tests was used for the comparisons between two groups or multiple groups. Data of three independent experiments were shown as the . When value < 0.05, it was considered to be statistically significant.

3. Results

3.1. circPVT1 Expression Was Upregulated in Osteosarcoma Tissues and Cells

Firstly, to investigate the function of circPVT1 in osteosarcoma, its expression level was examined in osteosarcoma tissues. Results showed that circPVT1 was increased in 52 osteosarcoma tissues relative to 45 normal tissues (Figure 1(a)). Then, according to the clinical information, 52 osteosarcoma patients were divided into the chemosensitive group () and the chemoresistant group (). Our data suggested that the expression of circPVT1 was apparently higher in the chemoresistant group compared with the chemosensitive group (Figure 1(b)). Given the well-known roles of ABCB1 and MRP-1 in multidrug resistance, their expression levels were detected in osteosarcoma by a western blot assay. As displayed in Figures 1(c) and 1(d), the significant upregulation of ABCB1 and MRP-1 was viewed in osteosarcoma tissues and the chemoresistant group when compared with their respective control groups. Moreover, we further verified that circPVT1 was expressed at a high level in DXR-resistant osteosarcoma cells (KHOS/DXR and U2OS/DXR) versus parental osteosarcoma cells (KHOS and U2OS) and human fetal osteoblastic cell line (hFOB1.19) (Figure 1(e)). Meanwhile, our data suggested that the protein levels of ABCB1 and MRP-1 were increased in DXR-resistant osteosarcoma cells (KHOS/DXR and U2OS/DXR) in comparison with parental osteosarcoma cells (KHOS and U2OS) (Figure 1(f)). In a word, the dysregulation of circPVT1 might be associated with DXR resistance in osteosarcoma.

3.2. circPVT1 Knockdown Improved DXR Sensitivity in DXR-Resistant Osteosarcoma Cells

Considering the higher expression of circPVT1 in KHOS/DXR and U2OS/DXR cells, we knocked down circPVT1 in those cell lines. As shown in Figure 2(a), the expression level of circPVT1 was markedly decreased in si-circ-transfected KHOS/DXR and U2OS/DXR cells compared to cells transfected with si-NC. Then, we used the knocking down systems to further identify the effects of circPVT1 on DXR resistance in osteosarcoma cells. At first, transfected cells were treated with various concentrations of DXR for 48 h, and then, the IC50 value was detected by the CCK-8 assay. Results suggested that the IC50 value of DXR in KHOS/DXR and U2OS/DXR cells transfected with si-circ was lower than that in cells transfected with si-NC (Figure 2(b)). Moreover, the cell colony formation and flow cytometry assays indicated that circPVT1 knockdown led to a substantial decline in the clone number and a striking increase in the apoptosis rate in KHOS/DXR and U2OS/DXR cells (Figures 2(c) and 2(d)). To further verify the role of circPVT1 in DXR resistance in osteosarcoma cells, the apoptosis-related proteins (antiapoptotic factor: Bcl-2 and proapoptotic factor: c-caspase-3) and multidrug-resistant proteins (ABCB1 and MRP-1) were detected in KHOS/DXR and U2OS/DXR cells. As expected, the decreased protein levels of Bcl-2, ABCB1, and MRP-1 and increased c-caspase-3 levels were observed caused by the silencing of circPVT1 in KHOS/DXR and U2OS/DXR cells (Figure 2(e)). These data manifested that circPVT1 depletion sensitized KHOS/DXR and U2OS/DXR cells to DXR.

3.3. miR-137 Acted as a Target of circPVT1

Previous studies have presented that miR-137 worked as a tumor suppressor in osteosarcoma [29]. Thus, we detected the expression level of miR-137 in osteosarcoma tissues by the RT-qPCR assay. Data exhibited that miR-137 was reduced in osteosarcoma tissues () compared with normal tissues () (Figure 3(a)). More importantly, we found a significant decrease of miR-137 in the chemoresistant group and DXR-resistant osteosarcoma cells (KHOS/DXR and U2OS/DXR) (Figures 3(b) and 3(c)), implying the involvement of miR-137 in DXR resistance in osteosarcoma cells. Moreover, the miR-137 expression level was inversely correlated with the circPVT1 level in osteosarcoma cells (Figure 3(d)). Therefore, we explored the relationship between miR-137 and circPVT1 by using starbase 3.0. As presented in Figure 3(e), there were some complementary sites between circPVT1 and miR-137. To confirm the prediction, a dual-luciferase reporter assay was conducted in 293T cells. Data suggested that miR-137 mimic declined the luciferase activity of circPVT1 wt reporter vector but had no apparent impact on luciferase activity of circPVT1 mut reporter vector (Figure 3(f)). Then, to further validate the mutual effect of circPVT1 and miR-137 at endogenous levels, the RIP assay was carried out in KHOS/DXR and U2OS/DXR cells. As presented in Figure 3(g), circPVT1 and miR-137 were obviously enriched in Ago2 pellets of KHOS/DXR and U2OS/DXR cell extracts when compared with the IgG control group. Collectively, these data suggested that circPVT1 could directly bind with miR-137.

3.4. circPVT1 Silencing Enhanced DXR Sensitivity in DXR-Resistant Osteosarcoma Cells by Targeting miR-137

As mentioned above, circPVT1 played an important role in DXR resistance of osteosarcoma cells, and miR-137 served as a target of circPVT1. Hence, to explore whether circPVT1 could regulate DXR resistance of osteosarcoma cells by targeting miR-137, we performed the rescue experiments. As shown in Figure 4(a), the knockdown of circPVT1 promoted the expression level of miR-137, while the introduction of miR-137 inhibitor abated the effect on KHOS/DXR and U2OS/DXR cells. Moreover, IC50 determination indicated that circPVT1 silencing notably reduced DXR resistance in KHOS/DXR and U2OS/DXR cells, which was abolished by the downregulation of miR-137 (Figure 4(b)). Also, miR-137 inhibitor strikingly abrogated si-circ-triggered reduction in the number of colonies and enhancement in the apoptosis rate in KHOS/DXR and U2OS/DXR cells (Figures 4(c) and 4(d)). In addition, western blot results suggested that the inhibition of Bcl-2, ABCB1, and MRP-1 and the promotion of c-caspase-3 due to the circPVT1 knockdown were reversed by miR-137 inhibitor in KHOS/DXR and U2OS/DXR cells (Figure 4(e)). All of these results suggested that the downregulation of miR-137 could partly abolish the circPVT1-silencing-induced DXR sensitivity in DXR-resistant osteosarcoma cells.

3.5. TRIAP1 Was a Target of miR-137

It has been reported that TRIAP1 was related to drug chemosensitivity in osteosarcoma cells. So, the expression level of TRIAP1 was examined in osteosarcoma. RT-qPCR and western blot analysis verified that TRIAP1 was increased in the osteosarcoma tissues and the chemoresistant group relative to their respective controls (Figures 5(a)5(d)). Meanwhile, we further proved that both mRNA level and protein level of TRIAP1 were distinctly upregulated in the DXR-resistant osteosarcoma cells (KHOS/DXR and U2OS/DXR) in comparison with other cells (Figures 5(e) and 5(f)). Interestingly, there was a negative correlation between TRIAP1 and miR-137 in osteosarcoma tissues (Figure 5(g)). As widely believed, miRNAs could exert the function by interacting with the target genes. By using bioinformatic software starbase 3.0, TRIAP1 was found to have some complementary base pairing with miR-137 (Figure 5(h)). Then, the latent binding was detected in 293T cells through a dual-luciferase reporter assay. Results suggested that the exogenetic expression of miR-137 prominently repressed the luciferase activity of TRIAP1 3UTR wt reporter plasmid but not that of TRIAP1 3UTR mut reporter plasmid (Figure 5(i)). Consistent with bioinformatic analysis and luciferase assay, the RIP assay indicated that the levels of miR-137 and TRIAP1 were specifically enriched in the anti-Ago2 group compared with the anti-IgG group in KHOS/DXR and U2OS/DXR cells (Figure 5(j)). Besides, the transfection efficiency of miR-137 mimic was detected in KHOS/DXR and U2OS/DXR cells. As exhibited in Figure 5(k), compared with cells transfected with mimic NC, the miR-137 level was evidently increased in miR-137 mimic-transfected KHOS/DXR and U2OS/DXR cells. All in all, miR-137 could interact with TRIAP1.

3.6. TRIAP1 Upregulation Partially Abrogated the Inductive Effect of miR-137 Improved on DXR Sensitivity in DXR-Resistant Osteosarcoma Cells

Next, we explored the regulatory role of miR-137 and TRIAP1 on DXR resistance in osteosarcoma cells. Firstly, the overexpression efficiency of oe-TRIAP1 was examined and shown in Figures 6(a) and 6(b). Then, the drug resistance assay suggested that the miR-137 mimic enhanced DXR sensitivity in KHOS/DXR and U2OS/DXR cells, while the reintroduction of oe-TRIAP1 mitigated these effects (Figure 6(c)). What is more, TRIAP1 overexpression attenuated the inhibitory effect of miR-137 mimic on the clone number in KHOS/DXR and U2OS/DXR cells (Figure 6(d)). Synchronously, oe-TRIAP1 abrogated the positive impact of miR-137 upregulation on the apoptosis rate in KHOS/DXR and U2OS/DXR cells (Figure 6(e)). Additionally, we further assessed the effect of miR-137 and TRIAP1 on the protein levels of Bcl-2, c-caspase-3, ABCB1, and MRP-1. Data indicated that the overexpression of TRIAP1 significantly reversed miR-137 mimic-caused decrease in Bcl-2, ABCB1, and MRP-1 and increase in c-caspase-3 in KHOS/DXR and U2OS/DXR cells (Figure 6(f)). Taken together, these results suggested that miR-137 could reinforce DXR sensitivity through modulating TRIAP1.

3.7. TRIAP1 Was Positivity Regulated by circPVT1/miR-137

Based on the above findings, we speculated that circPVT1 could exert the role through regulating the miR-137/TRIAP1 axis. Therefore, we used the rescue assays to verify the assumption. As presented in Figures 7(a) and 7(b), the knockdown of circPVT1 blocked the mRNA level and protein level of TRIAP1 in KHOS/DXR and U2OS/DXR cells; however, miR-137 inhibitor could reverse these effects. That was to say, circPVT1 could positively regulate TRIAP1 through sponging miR-137.

3.8. circPVT1 Knockdown Hindered Tumor Growth in Osteosarcoma Cells In Vivo

In addition, to confirm the functional effect of circPVT1 on tumor growth in vivo, a xenograft tumor mouse model was established. As shown in Figures 8(a) and 8(b), the tumor volume and tumor weight reduced in the presence of circPVT1 knockdown, implying that the silencing of circPVT1 could block osteosarcoma tumor growth in vivo. Furthermore, RT-qPCR assays indicated that the levels of circPVT1 and TRIAP1 were declined in tumor tissues from sh-circ-transfected KHOS/DXR cells, whereas the miR-137 level was enhanced (Figure 8(c)). Also, western blot results proved that the TRIAP1 protein level was remarkably lower in tumor tissues from the sh-circ group than the sh-NC group (Figure 8(d)). Meanwhile, the decreased protein levels of Bcl-2, ABCB1, and MRP-1 and increased c-caspase-3 level were observed in the sh-circ group versus the sh-NC group (Figure 8(e)). All of these data suggested that circPVT1 knockdown could inhibit tumor growth and improved drug sensitivity in osteosarcoma in vivo.

4. Discussion

Currently, it has been acknowledged that DXR is an effective chemotherapy drug for the treatment of osteosarcoma patients [30, 31], but drug resistance is becoming a predominant cause of failure. In recent years, the biological functions of circRNAs have been gradually identified due to the development of bioinformatic analysis and high-throughput sequencing [3234]. In fact, some studies have confirmed that circRNAs are related to the development of chemotherapeutic resistance in human cancers, including osteosarcoma [3537]. Noticeably, as a carcinogenic factor, a higher circPVT1 expression level has been exhibited in osteosarcoma cell lines [13, 38]. Furthermore, a recent document presented that the upregulation of circPVT1 expedited the resistance of osteosarcoma cells to DXR [14]. Yet, the potential mechanism of circPVT1 in DXR-resistant osteosarcoma is still unclear.

In this paper, circPVT1 was presented to exert high expression in DXR-resistant osteosarcoma tissues and cell lines, consistent with earlier studies [14]. Also, as an ATP-binding cassette member, ABCB1 known as P-glycoprotein (P-gp) has been identified as one of the important mechanisms of drug resistance through boosting the efflux of chemotherapeutic drugs from cancer cells [3941]. Multidrug resistance-associated protein 1 (MRP-1/ABCC1), a member of the ATP-binding cassette, produced multidrug resistance by actively exporting antitumor drugs clinically [42, 43]. In this study, the high expression of ABCB1 and MRP-1 was viewed in DXR-resistant osteosarcoma tissues and cell lines, confirming the drug resistance of osteosarcoma tissues and cells. Functionally, circPVT1 deficiency enhanced DXR sensitivity, curbed DXR-caused cell proliferation, and facilitated DXR-triggered apoptosis in DXR-resistant osteosarcoma cells in vitro. More importantly, our results verified that the knockdown of circPVT1 could block ABCB1 and MRP-1 levels in DXR-resistant osteosarcoma cells, implying that circPVT1 silencing might mitigate the drug resistance of osteosarcoma cells. Apart from that, the drug resistance of circPVT1 was also verified in osteosarcoma in vivo.

Recently, one hypothesis is that circRNAs could exert their effects through serving as a sponge for miRNAs [44]. In this paper, we found that miR-137 was expressed at a low level in DXR-resistant osteosarcoma tissues and cell lines, in agreement with some previous reports [22]. In osteosarcoma tissues, we found a negative correlation between circPVT1 and miR-137. Therefore, using the online-based bioinformatic software starbase 3.0, we observed that miR-137 could interact with circPVT1, as demonstrated by dual-luciferase reporter and RIP assays. Functional analysis presented that the knockdown of miR-137 could partly abrogate the circPVT1 silencing-triggered improvement in DXR sensitivity. In accordance with our data, the inductive impact of miR-137 on DXR sensitivity was confirmed in breast cancer [45] and neuroblastoma [46].

Up to now, it has been confirmed that miRNAs could exert the role by the interaction with their target genes [47]. In the manuscript, an apparent increase of TRIAP1 was viewed in DXR-resistant osteosarcoma tissues and cell lines. Also, the TRIAP1 level was inversely related to miR-137 in osteosarcoma tissues. A prior study has pointed out that TRIAP1 was implicated in chemosensitivity in osteosarcoma [26]. Hence, TRIAP1 was chosen for in-depth investigations. In the paper, our results confirmed that TRIAP1, as a direct target of miR-137, partly reversed the promotion effect of miR-137 overexpression on DXR sensitivity. In addition, mechanistic analysis verified that miR-137 inhibitor could partly overturn the suppression effect of circPVT1 silencing on the TRIAP1 level in DXR-resistant osteosarcoma cells, validating that circPVT1 could function as a sponge of miR-137 to upregulate TRIAP1 expression.

5. Conclusion

Our findings first proved that the regulatory role of circPVT1 in DXR resistance of osteosarcoma was mediated by the miR-137/TRIAP1 axis, providing an underlying circRNA-targeted therapy for osteosarcoma.

Data Availability

Please contact the correspondence author for the data request.

Ethical Approval

The hospital’s Institutional Review Board approved the current study.

Conflicts of Interest

The authors declare that they have no financial conflicts of interest.

Acknowledgments

This work was supported by the Natural Science Fund of Science and Technology Development Project, Science and Technology Agency of Jilin Province (No. 20160101002JC).

References

  1. E. Simpson and H. L. Brown, “Understanding osteosarcomas,” Journal of the American Academy of Physician Assistants, vol. 31, no. 8, pp. 15–19, 2018. View at: Publisher Site | Google Scholar
  2. F. He, W. Zhang, Y. Shen et al., “Effects of resection margins on local recurrence of osteosarcoma in extremity and pelvis: systematic review and meta-analysis,” International Journal of Surgery, vol. 36, no. Part A, pp. 283–292, 2016. View at: Publisher Site | Google Scholar
  3. A. Luetke, P. A. Meyers, I. Lewisand, and H. Juergens, “Osteosarcoma treatment - where do we stand? A state of the art review,” Cancer Treatment Reviews, vol. 40, no. 4, pp. 523–532, 2014. View at: Publisher Site | Google Scholar
  4. S. S. Bielack, B. Kempf-Bielack, G. Delling et al., “Prognostic factors in high-grade osteosarcoma of the extremities or trunk: an analysis of 1,702 patients treated on neoadjuvant cooperative osteosarcoma study group protocols,” Journal of Clinical Oncology, vol. 20, no. 3, pp. 776–790, 2002. View at: Publisher Site | Google Scholar
  5. H. He, J. Ni, and J. Huang, “Molecular mechanisms of chemoresistance in osteosarcoma (review),” Oncology Letters, vol. 7, no. 5, pp. 1352–1362, 2014. View at: Publisher Site | Google Scholar
  6. K. K. Ebbesen, J. Kjemsand, and T. B. Hansen, “Circular RNAs: identification, biogenesis and function,” Biochimica et Biophysica Acta, vol. 1859, no. 1, pp. 163–168, 2016. View at: Publisher Site | Google Scholar
  7. J. U. Guo, V. Agarwal, H. Guo, and D. P. Bartel, “Expanded identification and characterization of mammalian circular RNAs,” Genome Biology, vol. 15, no. 7, p. 409, 2014. View at: Publisher Site | Google Scholar
  8. P. Li, X. Yang, W. Yuan et al., “circRNA-Cdr1as exerts anti-oncogenic functions in bladder cancer by sponging microRNA-135a,” Cellular Physiology and Biochemistry, vol. 46, no. 4, pp. 1606–1616, 2018. View at: Publisher Site | Google Scholar
  9. J. Han, G. Zhao, X. Ma et al., “circRNA circ-BANP-mediated miR-503/LARP1 signaling contributes to lung cancer progression,” Biochemical and Biophysical Research Communications, vol. 503, no. 4, pp. 2429–2435, 2018. View at: Publisher Site | Google Scholar
  10. L. Dong and F. Qu, “CircUBAP2 promotes SEMA6D expression to enhance the cisplatin resistance in osteosarcoma through sponging miR-506-3p by activating Wnt/β-catenin signaling pathway,” Journal of Molecular Histology, vol. 51, no. 4, pp. 329–340, 2020. View at: Google Scholar
  11. F. Zheng and R. Xu, “circPVT1 contributes to chemotherapy resistance of lung adenocarcinoma through miR-145-5p/ABCC1 axis,” Biomedicine & Pharmacotherapy, vol. 124, p. 109828, 2020. View at: Publisher Site | Google Scholar
  12. Y. Y. Liu, L. Y. Zhang, and W. Z. Du, “Circular RNA circ-PVT1 contributes to paclitaxel resistance of gastric cancer cells through the regulation of ZEB1 expression by sponging miR-124-3p,” Bioscience Reports, vol. 39, no. 12, 2019. View at: Publisher Site | Google Scholar
  13. M. Yan, H. Gao, Z. Lv et al., “Circular RNA PVT1 promotes metastasis via regulating of miR-526b/FOXC2 signals in OS cells,” Journal of Cellular and Molecular Medicine, vol. 24, no. 10, pp. 5593–5604, 2020. View at: Publisher Site | Google Scholar
  14. Z. Kun-Peng, M. Xiao-Long, and Z. Chun-Lin, “Overexpressed circPVT1, a potential new circular RNA biomarker, contributes to doxorubicin and cisplatin resistance of osteosarcoma cells by regulating ABCB1,” International Journal of Biological Sciences, vol. 14, no. 3, pp. 321–330, 2018. View at: Publisher Site | Google Scholar
  15. S. M. Hammond, “An overview of microRNAs,” Advanced Drug Delivery Reviews, vol. 87, pp. 3–14, 2015. View at: Publisher Site | Google Scholar
  16. J. F. Wen, Y. Q. Jiang, C. Li, X. K. Dai, T. Wu, and W. Z. Yin, “LncRNA-SARCC sensitizes osteosarcoma to cisplatin through the miR-143-mediated glycolysis inhibition by targeting hexokinase 2,” Cancer Biomarkers : Section A of Disease Markers, vol. 28, no. 2, pp. 231–246, 2020. View at: Publisher Site | Google Scholar
  17. W. Liang, C. Li, M. Li, D. Wang, and Z. Zhong, “MicroRNA-765 sensitizes osteosarcoma cells to cisplatin via downregulating APE1 expression,” Oncotargets and Therapy, vol. 12, pp. 7203–7214, 2019. View at: Publisher Site | Google Scholar
  18. R. Chen, G. Wang, Y. Zheng, Y. Hua, and Z. Cai, “Drug resistance-related microRNAs in osteosarcoma: translating basic evidence into therapeutic strategies,” Journal of Cellular and Molecular Medicine, vol. 23, no. 4, pp. 2280–2292, 2019. View at: Publisher Site | Google Scholar
  19. M. Xue, W. Hong, J. Jiang, F. Zhao, and X. Gao, “Circular RNA circ-LDLRAD3 serves as an oncogene to promote non-small cell lung cancer progression by upregulating SLC1A5 through sponging miR-137,” RNA Biology, vol. 17, no. 12, pp. 1811–1822, 2020. View at: Publisher Site | Google Scholar
  20. W. Li, J. Ge, J. Xie, J. Yang, J.'. Chen, and T. He, “LncRNATUG1Promotes hepatocellular carcinoma migration and invasion via targeting miR-137/AKT2 axis,” Cancer Biotherapy & Radiopharmaceuticals, vol. 00, 2020. View at: Publisher Site | Google Scholar
  21. H. Li, J. Cui, B. Xu, S. He, H. Yang, and L. Liu, “Long non-coding RNA XIST serves an oncogenic role in osteosarcoma by sponging miR-137,” Experimental and Therapeutic Medicine, vol. 17, no. 1, pp. 730–738, 2019. View at: Publisher Site | Google Scholar
  22. X. Sun, C. Tian, H. Zhang et al., “Long noncoding RNA OIP5-AS1 mediates resistance to doxorubicin by regulating miR-137-3p/PTN axis in osteosarcoma,” Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, vol. 128, article 110201, 2020. View at: Publisher Site | Google Scholar
  23. C. Adams, G. Cazzanelli, S. Rasul et al., “Apoptosis inhibitor TRIAP1 is a novel effector of drug resistance,” Oncology Reports, vol. 34, no. 1, pp. 415–422, 2015. View at: Publisher Site | Google Scholar
  24. T. M. Zhang, “TRIAP1 inhibition activates the cytochrome c/Apaf-1/caspase-9 signaling pathway to enhance human ovarian cancer sensitivity to cisplatin,” Chemotherapy, vol. 64, no. 3, pp. 119–128, 2019. View at: Publisher Site | Google Scholar
  25. Y. Luo, T. Hua, X. You, J. Lou, X. Yang, and N. Tang, “Effects of miR-107 on the chemo-drug sensitivity of breast cancer cells,” Open Medicine, vol. 14, no. 1, pp. 59–65, 2019. View at: Publisher Site | Google Scholar
  26. L. Yu, M. Meng, Y. Bao et al., “miR-1301/TRIAP1 axis participates in epirubicin-mediated anti-proliferation and pro-apoptosis in osteosarcoma,” Yonsei Medical Journal, vol. 60, no. 9, pp. 832–841, 2019. View at: Publisher Site | Google Scholar
  27. M. Xu, H. Jin, C. X. Xu, W. Z. Bi, and Y. Wang, “miR-34c inhibits osteosarcoma metastasis and chemoresistance,” Medical Oncology, vol. 31, no. 6, p. 972, 2014. View at: Publisher Site | Google Scholar
  28. J. Zhou, S. Wu, Y. Chen et al., “MicroRNA-143 is associated with the survival of ALDH1+CD133+ osteosarcoma cells and the chemoresistance of osteosarcoma,” Experimental Biology and Medicine, vol. 240, no. 7, pp. 867–875, 2015. View at: Publisher Site | Google Scholar
  29. Q. Feng, Q. Wu, X. Liu, Y. Xiong, and H. Li, “MicroRNA-137 acts as a tumor suppressor in osteosarcoma by targeting enhancer of zeste homolog 2,” Experimental and Therapeutic Medicine, vol. 13, no. 6, pp. 3167–3174, 2017. View at: Publisher Site | Google Scholar
  30. D. Yu, S. Zhang, A. Feng et al., “Methotrexate, doxorubicin, and cisplatinum regimen is still the preferred option for osteosarcoma chemotherapy: a meta-analysis and clinical observation,” Medicine, vol. 98, no. 19, article e15582, 2019. View at: Publisher Site | Google Scholar
  31. B. Zhang, Y. Zhang, R. Li, J. Li, X. Lu, and Y. Zhang, “The efficacy and safety comparison of first-line chemotherapeutic agents (high-dose methotrexate, doxorubicin, cisplatin, and ifosfamide) for osteosarcoma: a network meta-analysis,” Journal of Orthopaedic Surgery and Research, vol. 15, no. 1, p. 51, 2020. View at: Publisher Site | Google Scholar
  32. S. Qu, X. Yang, X. Li et al., “Circular RNA: a new star of noncoding RNAs,” Cancer Letters, vol. 365, no. 2, pp. 141–148, 2015. View at: Publisher Site | Google Scholar
  33. Q. Xu, B. Deng, M. Li, Y. Chen, and L. Zhuan, “circRNA-UBAP2 promotes the proliferation and inhibits apoptosis of ovarian cancer though miR-382-5p/PRPF8 axis,” Journal of Ovarian Research, vol. 13, no. 1, p. 81, 2020. View at: Publisher Site | Google Scholar
  34. H. Liu, Y. Liu, Z. Bian et al., “Circular RNA YAP1 inhibits the proliferation and invasion of gastric cancer cells by regulating the miR-367-5p/p27 Kip1 axis,” Molecular cancer, vol. 17, no. 1, pp. 1–15, 2018. View at: Google Scholar
  35. Z. Kun-Peng, M. Xiao-Long, Z. Lei, Z. Chun-Lin, H. Jian-Ping, and Z. Tai-Cheng, “Screening circular RNA related to chemotherapeutic resistance in osteosarcoma by RNA sequencing,” Epigenomics, vol. 10, no. 10, pp. 1327–1346, 2018. View at: Publisher Site | Google Scholar
  36. Z. Kun-Peng, Z. Chun-Lin, H. Jian-Ping, and Z. Lei, “A novel circulating hsa_circ_0081001 act as a potential biomarker for diagnosis and prognosis of osteosarcoma,” International Journal of Biological Sciences, vol. 14, no. 11, pp. 1513–1520, 2018. View at: Publisher Site | Google Scholar
  37. K. P. Zhu, C. L. Zhang, X. L. Ma, J. P. Hu, T. Cai, and L. Zhang, “Analyzing the interactions of mRNAs and ncRNAs to predict competing endogenous RNA networks in osteosarcoma chemo-resistance,” Molecular Therapy, vol. 27, no. 3, pp. 518–530, 2019. View at: Publisher Site | Google Scholar
  38. Y. P. Liu, J. Wan, F. Long, J. Tian, and C. Zhang, “circPVT1 facilitates invasion and metastasis by regulating miR-205-5p/c-FLIP axis in osteosarcoma,” Cancer Management and Research, vol. 12, pp. 1229–1240, 2020. View at: Publisher Site | Google Scholar
  39. Y. Zhang, T. Zhou, J. Duan, Z. Xiao, G. Li, and F. Xu, “Inhibition of P-glycoprotein and glutathione S-transferase-pi mediated resistance by fluoxetine in MCF-7/ADM cells,” Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, vol. 67, no. 8, pp. 757–762, 2013. View at: Publisher Site | Google Scholar
  40. O. Bruhn and I. Cascorbi, “Polymorphisms of the drug transporters ABCB1, ABCG2, ABCC2 and ABCC3 and their impact on drug bioavailability and clinical relevance,” Expert Opinion on Drug Metabolism & Toxicology, vol. 10, no. 10, pp. 1337–1354, 2014. View at: Publisher Site | Google Scholar
  41. Y. H. Choi and A. M. Yu, “ABC transporters in multidrug resistance and pharmacokinetics, and strategies for drug development,” Current Pharmaceutical Design, vol. 20, no. 5, pp. 793–807, 2014. View at: Publisher Site | Google Scholar
  42. S. M. He, R. Li, J. R. Kanwar, and S. F. Zhou, “Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1),” Current Medicinal Chemistry, vol. 18, no. 3, pp. 439–481, 2011. View at: Publisher Site | Google Scholar
  43. M. K. DeGorter, G. Conseil, R. G. Deeley, R. L. Campbell, and S. P. Cole, “Molecular modeling of the human multidrug resistance protein 1 (MRP1/ABCC1),” Biochemical and Biophysical Research Communications, vol. 365, no. 1, pp. 29–34, 2008. View at: Publisher Site | Google Scholar
  44. D. Dudekula, A. Panda, I. Grammatikakis, S. De, K. Abdelmohsen, and M. Gorospe, “CircInteractome: a web tool for exploring circular RNAs and their interacting proteins and microRNAs,” RNA Biology, vol. 13, no. 1, pp. 34–42, 2016. View at: Publisher Site | Google Scholar
  45. F. Du, L. Yu, Y. Wu et al., “miR-137 alleviates doxorubicin resistance in breast cancer through inhibition of epithelial-mesenchymal transition by targeting DUSP4,” Cell Death & Disease, vol. 10, no. 12, p. 922, 2019. View at: Publisher Site | Google Scholar
  46. G. Zhao, G. Wang, H. Bai et al., “Targeted inhibition of HDAC8 increases the doxorubicin sensitivity of neuroblastoma cells via up regulation of miR-137,” European Journal of Pharmacology, vol. 802, pp. 20–26, 2017. View at: Publisher Site | Google Scholar
  47. G. Di Leva, M. Garofalo, and C. M. Croce, “MicroRNAs in cancer,” Annual Review of Pathology, vol. 9, no. 1, pp. 287–314, 2014. View at: Publisher Site | Google Scholar

Copyright © 2021 Dan Li et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Related articles

No related content is available yet for this article.
 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views294
Downloads681
Citations

Related articles

No related content is available yet for this article.

Article of the Year Award: Outstanding research contributions of 2021, as selected by our Chief Editors. Read the winning articles.