BioMed Research International / 2021 / Article / Tab 1

Research Article

Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations

Table 1

Number of alleles, optimal amplification conditions, and fragment length of 29 alleles for the laboratory chickens.

LociPrimer sequence (5-3)Temperature(°C)Allele rangeApplicable groups

MCW0029GTGGACACCCATTTGTACCCTATG63.8139-188Outbred group
CATGCAATTCAGGACCGTGCA
ADL0293GTAATCTAGAAACCCCATCT53.9106-120Outbred group
ACATACCGCAGTCTTTGTTC
ADL0317AGTTGGTTTCAGCCATCCAT58.5177-219Outbred group
CCCAGAGCACACTGTCACTG
GCT0016TCCAAGGTTCTCCAGTTC52.2111-148Outbred group
GGCATAAGGATAGCAACAG
ADL0304GGGGAGGAACTCTGGAAATG53.9138-161Outbred group
CCTCATGCTTCGTGCTTTTT
LEI0074GACCTGGTCCTGACATGGGTG58.5221-243Outbred group
GTTTGCTGATTAGCCATCGCG
ADL328CACCCATAGCTGTGACTTTG53.9107-120Outbred group
AAAACCGGAATGTGTAACTG
GGANTEClGCGGGGCCGTTATCAGAGCA65.0139-194Outbred group
AGTGCAGGGCGCTCCTGGT
LEI094CAGGATGGCTGTTATGCTTCCA56.0176-211Outbred group
CACAGTGCAGAGTGGTGCGA
MCW0330TGGACCTCATCAGTCTGACAG58.5217-287Outbred group
AATGTTCTCATAGAGTTCCTGC
LEI0141CGCATTTGATGCATAACACATG52.2221-245Outbred group
AAGGCAAACTCAGCTGGAACG
MCW0087ATTTCTGCAGCCAACTTGGAG58.5268-289Outbred group
CTCAGGCAGTTCTCAAGAACA
MCW0347GCTTCCAGATGAGCTCCATGG52.0121-149Outbred group
CACAGCGCTGCAGCAACTG
ADL176TTGTGGATTCTGGTGGTAGC58.5183-200Outbred group
TTCTCCCGTAACACTCGTCA
ADL0201GCTGAGGATTCAGATAAGAC58.5111-151Outbred group
AATGGCYGACGTTTCACAGC
GGNCAMZOGTCACTAGGTTAGCAGCATG56.0234Outbred group
GCTGGATACAGACCTCGATTHaplotype
GGAVIRAGAGATGGTGCACGCAACCT60.786-89Outbred group
CGAGCACTTTCTGGCAGAGAHaplotype
MCW0063GGCTCCAAAAGCTTGTTCTTAGCT53.9116-146Outbred group
GAAAACCAGTAAAGCTTCTTACHaplotype
ADL185CATGGCAGCTGACTCCAGAT58.5116-142Outbred group
AGCGTTACCTGTTCGTTTGCHaplotype
GGMYCCGAGGCGCTCTGCGAGTTTA62.4139-151Outbred group
TGGGGACCTCTGGCTCTGACHaplotype
LEI0094GATCTCACCAGTATGAGCTGC53.9250-283Outbred group
TCTCACACTGTAACACAGTGCHaplotype
GGVITCAGCCATCATTCAGGGCATCT58.586Outbred group
GATGTCCTGAGTGATGCTCAHaplotype
ADL0292CCAAATCAGGCAAAACTTCT58.5110-136Outbred group
AAATGGCCTAAGGATGAGGAHaplotype
GGVITIIGGGCAGGTTTCTAATGCCTGA56.0186-189Outbred group
CCCATCGTTTCAACTGTATGHaplotype
ADL166TGCCAGCCCGTAATCATAGG58.5131-154Outbred group
AAGCACCACGACCCAATCTAHaplotype
MCW0014AAAATATTGGCTCTAGGAACTGTC58.5172-195Outbred group
ACCGGAAATGAAGGTAAGACTAGCHaplotype
GGCYMAAGCGAGGCGCTCTGCGAGTT64.6140-153Outbred group
GGGCACCTCTGGCTCTGACCHaplotype
MCW0402ACTGTGCCTAGGACTAGCTG56.0141-229Outbred group
CCTAAGTCTGGGCTCTTCTGHaplotype
STMSGGHU2-1ACTTAATATGTGTGAGGTGGC53.9235-238Haplotype
GTTCTCACAATTGCATTAGC

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.