BioMed Research International / 2021 / Article / Tab 2

Research Article

Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations

Table 2

Number of alleles, optimal amplification conditions, and fragment length of 28 alleles for the laboratory ducks.

LociPrimer sequence(5-3)Temperature (°C)Allele rangeApplicable groups

CAUD007ACTTCTCTTGTAGGCATGTCA60.8100-190Outbred group
CACCTGTTGCTCCTGCTGT
CAUD004TCCACTTGGTAGACCTTGAG60.8234-385Outbred group
TGGGATTCAGTGAGAAGCCT
CAUD023CACATTAACTACATTTCGGTCT51.4163-234Outbred group
CAGCCAAAGAGTTCAACAGG
CAUD027AGAAGGCAGGCAAATCAGAG66.070-180Outbred group
TCCACTCATAAAAACACCCACA
CAUD001ACAGCTTCAGCAGACTTAGA55.5150-247Outbred group
GCAGAAAGTGTATTAAGGAAG
CAUD031AGCATCTGGACTTTTTCTGGA51.4107-187Outbred group
CACCCCAGGCTCTGAGATAA
CAUD032GAAACCAACTGAAAACGGGC58.196-206Outbred group
CCTCCTGCGTCCCAATAAG
AY314CTCATTCCAATTCCTCTGTA50.3112-329Outbred group
CAGCATTATTATTTCAGAAGG
CMO211GGATGTTGCCCCACATATTT55.0112-205Outbred group
TTGCCTTGTTTATGAGCCATT
APH09GGATGTTGCCCCACATATTT58.0134-190Outbred group
TTGCCTTGTTTATGAGCCATTA
APH11GGACCTCAGGAAAATCAGTGTA58.5183-185Outbred group
GCAGGCAGAGCAGGAAATA
APL2GATTCAACCTTAGCTATCAGTCTCC58.5115-125Outbred group
CGCTCTTGGCAAATGTCC
CAUD011TGCTATCCACCCAATAAGTG50.3145-223Outbred group
CAAAGTTAGCTGGTATCTGC
CAUD006ATGGTTCTCTGTAGGCAATC63.5183-290Outbred group
TTCTGCTTGGGCTCTTGGAHaplotype
CAUD018TTAGACAAATGAGGAAATAGTA50.3100-180Outbred group
GTCCAAACTAAATGCAGGCHaplotype
CAUD010GGATGTGTTTTTCATTATTGAT50.3138-200Outbred group
AGAGGCATAAATACTCAGTGHaplotype
CAUD012ATTGCCTTTCAGTGGAGTTTC63.5182-286Outbred group
CGGCTCTAAACACATGAATGHaplotype
CAUD014CACAACTGACGGCACAAAGT58.1136-200Outbred group
CTGAGTTTTTCCCGCCTCTAHaplotype
CAUD034TACTGCATATCACTAGAGGA55.5160-296Outbred group
TAGGCATACTCGGGTTTAGHaplotype
CAUD035GTGCCTAACCCTGATGGATG63.5174-282Outbred group
CTTATCAGATGGGGCTCGGAHaplotype
APL579ATTAGAGCAGGAGTTAGGAGAC55.0116-227Outbred group
GCAAGAAGTGGCTTTTTTCHaplotype
AY258ATGTCTGAGTCCTCGGAGC58.189-162Outbred group
ACAATAGATTCCAGATGCTGAAHaplotype
CMO212CTCCACTAGAACACAGACATT58.0186-272Outbred group
CATCTTTGGCATTTTGAAGHaplotype
CAUD028TACACCCAAGTTTATTCTGAG55.5152-226Outbred group
ACTCTCCAGGGCACTAGGHaplotype
CAUD026ACGTCACATCACCCCACAG60.8134-196Outbred group
CTTTGCCTCTGGTGAGGTTCHaplotype
APH18TTCTGGCCTGATAGGTATGAG58.0178-325Haplotype
GAATTGGGTGGTTCATACTGT
CAUD002CTTCGGTGCCTGTCTTAGC60.8200-231Haplotype
AGCTGCCTGGAGAAGGTCT
CAUD005CTGGGTTTGGTGGAGCATAA60.8184-290Haplotype
TACTGGCTGCTTCATTGCTG

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.