BioMed Research International / 2021 / Article / Tab 3

Research Article

Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations

Table 3

Number of alleles, optimal amplification conditions, and fragment length of 14 alleles for the outbred colony laboratory geese.

LociPrimer sequence(5-3)Temperature (°C)Allele range

G-Ans17ACAAATAACTGGTTCTAAGCAC51.0111–123
AGAGGACTTCTATTCATAAATA
G-TTUCG1CCCTGCTGGTATACCTGA53.0113-115
GTGTCTACACAACAGC
G-APH13CAACGAGTGACAATGATAAAA53.0163-165
CAATGATCTCACTCCCAATAG
G-Ans02TTCTGTGCAGGGGCGAGTT58.0202–230
AGGGAACCGATCACGACATG
G-Ans07GACTGAGGAACTACAATTGACT62.0236–246
ACAAAGACTACTACTGCCAAG
G-Ans18GTGTTCTCTGTTTATGATATTAC56.0229–237
AACAGAATTTGCTTGAAACTGC
G-Ans25CACTTATTAATGGCACTTGAAA62.0261–277
GTTCTCTTGTCACAACTGGA
G-Hhiμ1bATCAAAGGCACAATGTGAAAT60.0212–216
AGTAAGGGGGCTTCCACC
G-CKW47AACTTCTGCACCTAAAAACTGTCA56.0213-215
TGCTGAGGTAACAGGAATTAAAA
G-Bcaμ5AGTGTTTCTTTCATCTCCACAAGC56.0197-201
AGACCACAATCGGACCACATATTC
G-Bcaμ7TAGTTTCTATTTGCACCCAATGGAG60.0171-175
CGGTCCTGTCCTTGTGCTGTAA
G-Bcaμ8CCCAAGACTCACAAAACCAGAAAT58.0155-159
ATGAAAGAAGAGTTAAACGTGTGCAA
G-CAUD006ATGGTTCTCTGTAGGCAATC56.0170-210
TTCTGCTTGGGCTCTTGGA
G-APH20ACCAGCCTAGCAAGCACTGT53.0140-150
GAGGCTTTAGGAGAGATTGAAAAA

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.