BioMed Research International / 2021 / Article / Tab 4

Research Article

Development of Microsatellite Marker System to Determine the Genetic Diversity of Experimental Chicken, Duck, Goose, and Pigeon Populations

Table 4

Number of alleles, optimal amplification conditions, and fragment length of 16 alleles for the outbred colony laboratory pigeons.

LociPrimer sequence(5-3)Temperature (°C)Allele range

UU-Cli02TGGGCAAGGTACACTTTTAGGT61.0158-170
CTTTATGCTCCCCCTTGAGAT
UU-Cli06TTTGAAAAACATGGATTGTGC56.0140-145
AATTTGCAGAGGGTGAGTGG
PG5GTTCTTGGTGTTGCATGGATGC59.0262-266
AGTTACGAAATGATTGCCAGAAG
C26L9(1265223)CAAAGCTGCTGACGTGAATCAA59.0467-472
AGAGACGCTCCATGCAAAAG
UU-Cli14CAGAACGTTTTGTTCTGTTTGG58.0265-292
TCTTGCTGCAGTCTTCATCC
C12L1(532572)GTTGTTTGGCTGAGTGGACG62.0126-136
TCAACCAGGGGAATTGGCAG
C12L4(906353)GCTGCTGTCTTCTTCATTGGG60.0210-250
TTAAAACCTCCCGTCTCCCTG
CliμD11CCAATCCCAAAGAGGATTAT58.078-98
ACTGTCCTATGGCTGAAGTG
C26L10(1404758)GCTGTCAGGTATCAGCCACAA59.0211-226
TCAGACCCACGAAAGCTGTAA
C26L4(568923)CAACCCCATGTGGGTGAGAC63.0357-432
CACCACCACGTGGGACATC
PG4CCCATCTCCTGCCTGATGC64.0136-170
CACAGCAGGATGCTGCCTGC
UU-Cli12CGCCAGACTGTATTGTGAGC61.0231-265
AGCATGGCTGTTCTTTGAGG
CliμT47ATGTGTGTTTGTGCATGAAG56.0183-214
ATGAAAGCCTGTTAGTGGAA
CliμD32GAGCCATTTCAGTGAGTGACA60.0136-158
GTTTGCAGGAGCGTGTAGAGAAGT
UU-Cli07GCTGCCTGTTACTACCTGAGC61.0277-310
CTGGCCATGAAATGAACTCC
C26L1(20390)AGGAGCCTACACTGGGTTTTC60.0250-268
TGTAGCTCTGCAATCAGCCT

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.