Contribution of OqxAB Efflux Pump in Selection of Fluoroquinolone-Resistant Klebsiella pneumoniae

Table 1

Oligonucleotide primers and probes of this study.

Primer or probe	Sequence	Reference
gyrA fwd	CAGCCCTTCAATGCTGATG	Designed in the study
gyrA rev	CGCTTTTACTCCTTTTCTGTTC	Designed in the study
parC fwd	CTCAATCAGCGTAATCGCC	Designed in the study
parC rev	AATCCTCAGCCGATCTCAC	Designed in the study
Kpn.rpoBF1 fwd	GTCGCGGCTGAACAAGCT	Designed in the study
Kpn.rpoBR1 rev	AACGGCCACTTCGTAGAAGATC	Designed in the study
Kpn.rpoBP1-VIC probe	CTACGGCAGGTAACC	Designed in the study
oqxAF1 fwd	GTCGACGGCTTACAAAAAGTGTT	Designed in the study
oqxAR1 rev	GCAACGGTTTTGGCGTTAA	Designed in the study
oqxAP1-FAM probe	ATGCCGGGTATGCC	Designed in the study
oqxBF1 fwd	CTGGATTTTCCGTCCGTTTAAC	Designed in the study
oqxBR1 rev	TTGCCTACCAGTCCCTGATAGC	Designed in the study
oqxBP1-FAM probe	CTGCGCAGCTCGAA	Designed in the study