Canadian Journal of Infectious Diseases and Medical Microbiology / 2018 / Article / Tab 1

Research Article

Bifidobacterium lactis Ameliorates the Risk of Food Allergy in Chinese Children by Affecting Relative Percentage of Treg and Th17 Cells

Table 1

The primers used for real-time PCR.

GenesForward primer sequence (5′-3′)Reverse primer sequence (5′-3′)

The primers for human
FoxP3TTGAACCCCATGCCACCATCCATCCACCGTTGAGAGCTGG
TGF-βGGGCTTCTCCTACCCCTACCTTCCCCTTCTGGGATCTTG
IL-17ACCCGGACTGTGATGGTCAACGGAGGCTCCCTGCGCAGGAC
IL-23GATGAAGAGACTACAAATGGAGGCATGAAGCTGGCCCAC
β-ActinGGGCGTGATGGTGGGCATGTCGGTCAGCAGCACGGGGTG

The primers for mouse
FoxP3TTTCCAAGAACGGGCATTATGTGGCTGACTGAGGGTGT
TGF-βACCGCAACAACGCCATCTATGCACTGCTTCCCGAATGTCT
IL-17AAGGGAGAGCTTCATCTGTGGAGATTCATGGACCCCAACAG
IL-23TGCTGGATTGCAGAGCAGTAAGCATGCAGAGATTCCGAGAGA
β-ActinCGCAAAGACCTGTATGCCAATGGGCTGTGATCTCCTTCTGC

We are committed to sharing findings related to COVID-19 as quickly as possible. We will be providing unlimited waivers of publication charges for accepted research articles as well as case reports and case series related to COVID-19. Review articles are excluded from this waiver policy. Sign up here as a reviewer to help fast-track new submissions.