Case Reports in Genetics / 2013 / Article / Tab 1

Case Report

A Novel De Novo EFNB1 Gene Mutation in a Mexican Patient with Craniofrontonasal Syndrome

Table 1

PCR and sequencing primers for EFNB1.

Primer name5′-3′ orientationLength of PCR product (bp)

EFNB1-ex1-FAAGGCGAGGCGAGCTTTGGT318
EFNB1-ex1-RAAGCCGGAGACAAAATGAGG
EFNB1-ex2-FTTGTCCGCTTCCCTGGTTCT445
EFNB1-ex2-RATTGCACCACTTAGAAGCTCC
EFNB1-ex3-FGCTGAAGCAGAATGGGAGTT246
EFNB1-ex3-RGCCAGGAACATCTGTTCCAA
EFNB1-ex4-FGGTTACAGTATCCAGGCCAT312
EFNB1-ex4-RGCCCAGCTTGCATTTCTTCA
EFNB1-ex5-FTGAAGAAATGCAAGCTGGGC606
EFNB1-ex5-RATACAAAGGTGGGCACAGCT

We are committed to sharing findings related to COVID-19 as quickly and safely as possible. Any author submitting a COVID-19 paper should notify us at help@hindawi.com to ensure their research is fast-tracked and made available on a preprint server as soon as possible. We will be providing unlimited waivers of publication charges for accepted articles related to COVID-19. Sign up here as a reviewer to help fast-track new submissions.