Disease Markers

Disease Markers / 2021 / Article
Special Issue

Forensic and Clinical Applications of Biomarkers of Cardiovascular Disease

View this Special Issue

Research Article | Open Access

Volume 2021 |Article ID 8587535 | https://doi.org/10.1155/2021/8587535

Linlin Gao, Zhongbao Ruan, Gecai Chen, "MicroRNA-383-5p Regulates Oxidative Stress in Mice with Acute Myocardial Infarction through the AMPK Signaling Pathway via PFKM", Disease Markers, vol. 2021, Article ID 8587535, 9 pages, 2021. https://doi.org/10.1155/2021/8587535

MicroRNA-383-5p Regulates Oxidative Stress in Mice with Acute Myocardial Infarction through the AMPK Signaling Pathway via PFKM

Academic Editor: Simona Pichini
Received08 Oct 2021
Revised05 Nov 2021
Accepted07 Nov 2021
Published07 Dec 2021

Abstract

Objective. The purpose of this study is to explore the regulating role of microRNA-383-5p (miR-383-5p) in oxidative stress after acute myocardial infarction (AMI) through AMPK pathway via phosphofructokinase muscle-type (PFKM). Methods. We established the AMI model, and the model mice were injected with miR-383-5p agomir to study the effect of miR-383-5p in AMPK signaling pathways. The target gene for miR-383-5p was reported to be PFKM, so we hypothesized that overexpression of miR-383-5p inhibits activation of the AMPK signaling pathway. Results. In this research, we found that overexpression of miR-383-5p decreases myocardial oxidative stress, myocardial apoptosis, the expression level of PFKM malondialdehyde (MDA), and reactive oxygen species (ROS) in the myocardial tissues after AMI, and finally, AMI-induced cardiac systolic and diastolic function could be improved.Conclusion. This study demonstrated that miR-383-5p could reduce the oxidative stress after AMI through AMPK signaling pathway by targeting PFKM.

1. Introduction

AMI is the main cause of persistent increases in human morbidity and mortality due to obstruction of coronary blood flow [1]. Although cTnI and cTnT are the gold standard for evaluation of myocardial ischemia, we need the search for new biomarkers. AMI can lead to the formation of scar and the remodeling of left ventricular, including cardiac dysfunction and cardiomyocyte hypertrophy and fibrosis [2]. Therefore, it causes a decrease in cardiac output and ultimately leads to heart failure (HF) [3].

MicroRNAs (miRNAs) are a small noncoding RNAs composed of unequal nucleotides that regulate gene expression by binding to a fully complementary or partially complementary target mRNAs at the posttranscriptional level [4]. miRNAs are involved in gene expression during cell differentiation, inflammation, stress response, and proliferation [5, 6]. Emerging evidences show that miRNAs are involved in the pathogenesis of cardiac diseases [7]. Therefore, it may be possible that miRNAs have therapeutic effects [8]. In addition, some researches have shown that upregulation of miR-383-5p can inhibit cell proliferation [9, 10]. According to investigation, miR-383-5p could regulate cell viability through Wnt/β-catenin pathway [11]. It is well known that PFKM mutation is one of the most common lesions in breast cancer [12]. Besides, a previous study has discussed that oxidative stress in cardiomyocytes after AMI can cause cell injury through activated protein kinase (AMPK) signaling pathway [13]. And this research is aimed at investigating the effect of miR-383-5P targeting PFKM via AMPK pathway on oxidative stress in AMI.

2. Materials and Methods

2.1. Prediction of the Target Gene of miR-383-5p Sample Collection

The target gene of miR-383-5p was predicted using the miRDB, PicTar, and TargetScan databases. Then, a correlation analysis was performed on these target genes at the intersection using a String database. We searched for targets with known expression in cardiovascular tissues specifically.

2.2. Experimental Animal

In this study, male C57BL/6 mice, the age was six to eight weeks, and weighing  g were included to be raised by the specific pathogen free (SPF) animal center. The average temperature in the animal center is 20°C, the relative humidity is 50-70%, and the light maintenance day and night cycle is 12 h. The whole process is pellet feeding, free feeding, drinking water, and single cage feeding. The cage was cleaned daily, and the cleaning pad was replaced to keep the cage clean. Mice underwent coronary artery ligation, and we use electrocardiogram measurements for the production of myocardial infarction (MI) [14]. Only mice with significant ST-elevation in the ECG were included in the research. Mice were randomly divided into 4 groups: (1) sham group, (2) AMI+PBS group (AMI mice injected with PBS via tail vein), (3) AMI+miR-383-5p agomir group (AMI mice with miR-383-5p agomir injected via tail vein), and (4) AMI+miR-383-5p agomir NC group (AMI mice with miR-383-5p agomir NC injected via tail vein). Seven days after AMI, echocardiography measurements were performed. This study was approved by the Ethics Committee of Taizhou People’s Hospital Animal Center (18-CN-23TZ-EC031).

2.3. Echocardiography

Seven days after the AMI model was established, echocardiography was performed using ultrasound system to detect left ventricular end-diastolic volume (LVEDD), left ventricular end-systolic volume (LVESD), and left ventricular end-diastolic volume (LVEDV) and left ventricular end-systolic volume (LVESV). In this study, we evaluated cardiac function by calculating EF and FS.

2.4. Culture of H9C2 Cells

H9C2 cells were cultivated with Dulbecco’s Modified Eagle Medium (DMEM) culture solution (Gibco, Rockville, MD, USA), which contained 10% fetal bovine serum (FBS) (Gibco, Rockville, MD, USA) and penicillin/streptomycin, and the H9C2 cells cultivate in a culture dish (37°C, 5% CO2); we changed the medium every other day. The concentration of 2000 μM H2O2 was used for the construction of H9C2 cell injury model in vitro [15].

2.5. Dual Luciferase Reporter Gene Assay

We analyzed the target gene of miR-383-5p by biological prediction website. To find whether PFKM was a target gene for miR-383-5p, then in this research, we did a luciferase reporter assay for verification. Luc-PFKM-wt or Luc-PFKM-mut was cotransfected into cells with miR-383-5p mimic or its control. Luciferase activity was measured by transfection of H9C2 cardiomyocytes by dual luciferase assay system (Promega, Madison, WI, USA).

2.6. MDA Detection

The mouse serum was taken and centrifuged at 3000r for 10 minutes. After taking the supernatant, the serum MDA content was measured using a commercial kit (Jianglai, Shanghai, China).

2.7. Flow Cytometry

Detect intracellular ROS levels by flow cytometry. The mice were anesthetized by intraperitoneal injection and sacrificed. The myocardial tissues were separated and placed in 1 mL of ice PBS (Syme fisher technology, Boca Raton, FL, USA) liquid and cut. The cells were filtered through a 200-400 mesh screen and adjust the cell concentration. The prepared 1 mL single-cell suspension was incubated with 5 μl of 2,7-dichlorofluorescein diacetate (DCF-DA), and the supernatant was removed by centrifugation and then incubated with 10% FBS. After centrifugation at 4°C, myocardial tissue suspension was prepared. The average fluorescence intensity of the intracellular marker fluorescent probe was measured by flow cytometry (BD FACSC alibur type, Becton-Dickinson (BD), Franklin Lakes, NJ, USA). In the same way, H9C2 cells were treated with H2O2 in 6-well plate for 4 h. Cells were collected and washed with PBS twice and then resuspended with binding buffer. Annexin V-FITC and propidium iodide (BB-4101-2; BestBio Science, Shanghai, China) staining solution were added. The apoptotic cells were detected by flow cytometry (BD FACSC alibur type, Becton-Dickinson (BD), Franklin Lakes, NJ, USA).

2.8. Real-Time qPCR

Myocardial tissue RNA was extracted using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA). RNA pretreated with diethylpyrocarbonate (DEPC) (Beyotime, Shanghai, China) was dissolved in ultrapure water. The RNA concentration of the nanodroplets was measured, and the absorbance at 260 nm and 280 nm was measured. If the A260/A280 was between 1.8 and 2.1, the RNA quality was considered standard and can be used in subsequent experiments. We first synthesize complementary deoxyribose nucleic acid (cDNA) using a reverse transcription kit and then perform PCR amplification. mRNA quantitative analysis was achieved using Prism 7300 Sequence Detection System, and 25 μL reaction system was used including SYBR Green (12.5 μL, Thermo Fisher Scientific, Waltham, MA, USA), 10 Μm of primers (0.5 mL each from the stock, Thermo Fisher Scientific, Waltham, MA, USA), 10.5 μL of water, and 0.5 μL of template. The data was analyzed by the SDS software, and the results were then output to EXCEL for further analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serves as an internal reference for other mRNA and U6 as an internal reference for miR-383-5p. The comparison threshold period (Ct) method, that is, the 2-ΔΔCt method was used to calculate the folding magnification. All the primers are listed in Table 1.


Gene nameForward (5>3)Reverse (5>3)

SOD1GGTGAACCAGTTGTGTTGTCCCGTCCTTTCCAGCAGTC
SOD2CAGACCTGCCTTACGACTATGGCTCGGTGGCGTTGAGATTGTT
PFKMCATCGCCGTGTTGACCTCTCCCGTGAAGATACCAACTCGG
miR-383-5pGGGAGATCAGAAGGTGATTGTGGCTCAGTGCGTGTCGTGGAGT
GAPDHACAACTTTGGTATCGTGGAAGGGCCATCACGCCACAGTTTC

RT-PCR: quantitative reverse-transcription polymerase chain reaction.
2.9. Western Blotting Technology

Four groups of mouse myocardial tissue were taken in an eppendorf (EP) tube, and an appropriate amount of precooled cell lysis buffer was placed. The supernatant was taken by centrifugation at 4°C using a high-speed centrifuge. The concentration was quantified by bicinchoninic acid (BCA) kit (BCA, Construction, Nanjing, China). First, protein was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The dispersed proteins were then transferred to a polyvinylidene fluoride membrane for 4 h at 4°C. Incubate with 5% skim milk for 1 h. Second, incubate the membrane with a special primary antibody (PFKM, Abcam, Cambridge, MA, USA, Rabbit, 1 : 3000; SOD1, Abcam, Cambridge, MA, USA, Rabbit, 1 : 3000; SOD2, Abcam, Cambridge, MA, USA, Rabbit, 1 : 3000; AMPK, Abcam, Cambridge, MA, USA, Rabbit, 1 : 3000; and p-AMPK, Abcam, Cambridge, MA, USA, Rabbit, 1 : 3000). We rinse the membrane 3 times with tris buffered saline-tween (TBST) for 15 minutes each time. Next day, the membrane was bound to a second antibody for 1 h at 37°C and 3 times with TBST. Visual inspection of proteins was by the electrochemiluminescence (ECL) Plus detection system.

2.10. Statistical Analysis

All statistical results were presented as . The GraphPad Prism 5 Software (La Jolla, CA, USA) was used. Student’s -test was used to analyze the comparison between the two groups. values less than 0.05 were considered statistically significant results.

3. Results

3.1. PFKM Can Be Predicted Involving in Regulating the Oxidative Stress

The miRDB database and the TargetScan database were used to predict the target gene of miR-383-5p. In addition, the AMPK pathway is thought to be associated with the development of AMI. We found that PFKM was located in the AMPK signaling pathway.

3.2. PFKM Is a Target Gene of miR-383-5p

We found that there is a specific binding region between the 3UTR of PFKM and the miR-383-5p sequence through software analysis. So, we hypothesized that PFKM was a direct target gene of miR-383-5p (Figure 1(a)). We then used the dual luciferase reporter assay, and the results showed that miR-383-5p significantly downregulated PFKM-3UT-wt luciferase activity compared to NC group (), but PFKM-3UT-mut luciferase activity had no significant effect (). Therefore, we can obtain that miR-383-5p can specifically bind to PFKM-3UTR, thereby inhibiting PFKM gene expression (Figure 1(b)).

3.3. H2O2-Induced Upregulation of miR-383-5p Expression and Increased PFKM Expression in H9C2 Cells

Real-time qPCR and western blot were used to detect the expression of miR-383-5p and PFKM in normal H9C2 cells and H2O2-induced H9C2 cells at 4 h. And results showed that miR-383-5p expression was decreased (), but mRNA and protein expression levels of PFKM were significantly elevated in H2O2-induced H9C2 cells () (Figures 2(a)2(d)). Also, we did flow cytometry to detect the rate of apoptosis, and the result showed that apoptosis rate significantly increased in the H2O2 group (Figures 2(e)2(g)).

3.4. miR-383-5p Regulates the Expression of the AMPK Signaling Pathway Factors by Targeting PFKM

We used real-time qPCR to detect the expression of related genes to research the effect of miR-383-5p on AMPK signaling pathway. The results showed (Figure 3(a)) that compared with the sham group, the expression of miR-383-5p was significantly decreased in the AMI+PBS group (). In the AMI+miR-383-5p agomir group, miR-383-5p expression was significantly elevated (). At the same time, there was no significant difference of miR-383-5p expression in the AMI+miR-383-5p agomir NC group (). Western blot (Figures 3(b) and 3(c)) result showed that miR-383-5p agomir inhibited PFKM expression after AMI. In the miR-383-5p agomir group, the expression of SOD1 and SOD2 was increased. However, we found no significant difference in the AMI+miR-383-5p agomir NC group () (Figure 3(d)). mRNA also obtained similar results (Figures 3(e) and 3(f)). We can conclude that miR-383-5p overexpression can inhibit oxidative stress after AMI.

3.5. miR-383-5p Reduces the Effects of Oxidative Stress after AMI through the AMPK Signaling Pathway

Moreover, the phosphorylation of AMPK was significantly increased in the AMI+miR-383-5p agomir group (). In conclusion, miR-383-5p overexpression inhibits PFKM expression after AMI and activates AMPK signaling pathway, which in turn affects downstream factors () (Figures 4(a) and 4(b)). We all know that the level of MDA and ROS can reflect the oxidative stress level; then, we used MDA kit to study the effect of miR-383-5p on MDA and used flow cytometry to determine the level of ROS. The results (Figure 4(c) and 4(d)) showed that MDA and ROS levels increased in the AMI+PBS group (), and by contrast, MDA and ROS levels decreased significantly in the AMI+miR-383-5p agomir group (). miR-383-5p could decrease the levels of MDA and ROS through AMPK signaling pathway, thereby reducing oxidative stress of myocardium.

3.6. Overregulation of miR-383-5p Increased Cardiac Function in Mice

We used echocardiography to examine the heart function of mice (Figure 5(a)). The results confirmed that the AMI+miR-383-5p agomir group had a significant increase in cardiac function (Figures 5(b) and 5(c)): EF and FS (). In the AMI+miR-383-5p agomir NC group, the results had no significant difference (). And this study indicated that miR-383-5p agomir can relieve cardiac function after AMI.

4. Discussion

In this study, we demonstrated that miR-383-5p could reduce the oxidative stress after AMI through AMPK signaling pathway by targeting PFKM, thereby alleviating the redox imbalance produced by the heart after AMI and inhibiting cardiomyocyte apoptosis.

Our study demonstrated that increasing the expression of miR-383-5p may be a novel approach to AMI treatment strategies. Previous researches have found that abnormal expression of miRs was considered to play an important role in the diagnosis and treatment of various diseases such as heart disease [1618]. miR-383-5p was known to suppress carcinoma cell proliferation [19, 20] and could be acted as new prognostic biomarkers and therapeutic targets [21]. Furthermore, we used ROS level detection flow cytometry and immunofluorescence to detect intracellular ROS levels, and we used MDA kit to detect the effect of miR-383-5p on MDA levels. Our data suggest that miR-383-5p plays a key role in inhibiting oxidative stress in cardiomyocytes. Secondly, we successfully predicted that PFKM might be the target gene of miR-383-5p through software analysis. Therefore, we conducted a series of studies through in vivo and in vitro experiments. A lot of studies have investigated that AMPK pathway is involved in the oxidative stress progression [2224]. And PFKM was the gene enriched in the AMPK signaling pathway by KEGG in AMI. Our study showed that miR-383-5p was decreased after AMI, and when we increased its expression in mouse’s heart, cardiac function will be improved. However, decreasing the expression of miR-383-5p after AMI, we did not find the cardiac function deteriorated. And it might be explained by the fact that miR-383-5p has the low expression in the heart. We observed that microRNA-383-5p overexpression alleviates heart injury in vivo. On the one hand, microRNA-383-5p reduced the level of oxidative stress and thus reduces cell apoptosis [25, 26]. In addition, microRNA-383-5p may also reduce cell apoptosis directly.

However, the research also had some limitations. First, we did not have many researches in vitro. Second, to detect the level of oxidative stress, we only detect the levels of MDA and ROS, and we did not do other researches in apoptosis such as TUNNEL staining in vivo. Finally, this study was still on the way, and the mechanism was insufficient. It needs further verification on the effects of miR-383-5p or AMPK signaling pathway on oxidative stress for the treatment of AMI.

5. Conclusions

In conclusion, our study confirmed that miR-383-5p could reduce the oxidative stress after AMI through AMPK signaling pathway by targeting PFKM.

Data Availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declared no conflict of interest.

References

  1. J. A. Hill and E. N. Olson, “Cardiac plasticity,” The New England Journal of Medicine, vol. 358, no. 13, pp. 1370–1380, 2008. View at: Publisher Site | Google Scholar
  2. N. Maulik, “Angiogenic signal during cardiac repair,” Molecular and Cellular Biochemistry, vol. 264, no. 1/2, pp. 13–23, 2004. View at: Publisher Site | Google Scholar
  3. M. M. Lalu, S. Mazzarello, J. Zlepnig et al., “Safety and efficacy of adult stem cell therapy for acute myocardial infarction and ischemic heart failure (SafeCell Heart): a systematic review and meta-analysis,” Stem Cells Translational Medicine, vol. 7, no. 12, pp. 857–866, 2018. View at: Publisher Site | Google Scholar
  4. D. P. Bartel, “MicroRNAs: genomics, biogenesis, mechanism, and function,” Cell, vol. 116, no. 2, pp. 281–297, 2004. View at: Publisher Site | Google Scholar
  5. G. Condorelli, M. V. Latronico, and E. Cavarretta, “MicroRNAs in cardiovascular diseases: current knowledge and the road ahead,” Journal of the American College of Cardiology, vol. 63, no. 21, pp. 2177–2187, 2014. View at: Publisher Site | Google Scholar
  6. E. R. Porrello, “MicroRNAs in cardiac development and regeneration,” Clinical Science (London, England), vol. 125, no. 4, pp. 151–166, 2013. View at: Publisher Site | Google Scholar
  7. M. Climent, G. Viggiani, Y. W. Chen, G. Coulis, and A. Castaldi, “MicroRNA and ROS crosstalk in cardiac and pulmonary diseases,” International Journal of Molecular Sciences, vol. 21, no. 12, p. 4370, 2020. View at: Publisher Site | Google Scholar
  8. J. H. Park, S. Y. Shin, and C. Shin, “Non-canonical targets destabilize microRNAs in human Argonautes,” Nucleic Acids Research, vol. 45, no. 4, pp. 1569–1583, 2017. View at: Publisher Site | Google Scholar
  9. Z. Li and W. Li, “miR-383 inhibits proliferation of granulosa cells by down-regulation of cell cycle-related proteins in mice,” Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi, vol. 35, no. 6, pp. 518–525, 2019. View at: Google Scholar
  10. R. L. Han, F. P. Wang, P. A. Zhang, X. Y. Zhou, and Y. Li, “MiR-383 inhibits ovarian cancer cell proliferation, invasion and aerobic glycolysis by targeting LDHA,” Neoplasma, vol. 64, no. 2, pp. 244–252, 2017. View at: Publisher Site | Google Scholar
  11. B. Gu, J. Wang, Y. Song, Q. Wang, and Q. Wu, “MicroRNA-383 regulates cell viability and apoptosis by mediating Wnt/beta-catenin signaling pathway in non-small cell lung cancer,” Journal of Cellular Biochemistry, vol. 120, no. 5, pp. 7918–7926, 2018. View at: Google Scholar
  12. H. Ahsan, J. Halpern, M. G. Kibriya et al., “A genome-wide association study of early-onset breast cancer identifies PFKM as a novel breast cancer gene and supports a common genetic spectrum for breast cancer at any age,” Cancer Epidemiology, Biomarkers & Prevention, vol. 23, no. 4, pp. 658–669, 2014. View at: Publisher Site | Google Scholar
  13. R. Kar, D. R. Kellogg, and L. J. Roman, “Oxidative stress induces phosphorylation of neuronal NOS in cardiomyocytes through AMP-activated protein kinase (AMPK),” Biochemical and Biophysical Research Communications, vol. 459, no. 3, pp. 393–397, 2015. View at: Publisher Site | Google Scholar
  14. E. Gao, Y. H. Lei, X. Shang et al., “A novel and efficient model of coronary artery ligation and myocardial infarction in the mouse,” Circulation Research, vol. 107, no. 12, pp. 1445–1453, 2010. View at: Publisher Site | Google Scholar
  15. B. Su, S. D. Bu, B. H. Kong, R. X. Dai, and Q. Su, “Cystatin C alleviates H2O2-induced H9c2 cell injury,” European Review for Medical and Pharmacological Sciences, vol. 24, no. 11, pp. 6360–6370, 2020. View at: Publisher Site | Google Scholar
  16. A. S. Moghaddam, J. T. Afshari, S. A. Esmaeili, E. Saburi, Z. Joneidi, and A. A. Momtazi-Borojeni, “Cardioprotective microRNAs: lessons from stem cell-derived exosomal microRNAs to treat cardiovascular disease,” Atherosclerosis, vol. 285, pp. 1–9, 2019. View at: Publisher Site | Google Scholar
  17. B. C. Bernardo, J. Y. Ooi, R. C. Lin, and J. R. McMullen, “MiRNA therapeutics: a new class of drugs with potential therapeutic applications in the heart,” Future Medicinal Chemistry, vol. 7, no. 13, pp. 1771–1792, 2015. View at: Publisher Site | Google Scholar
  18. D. A. Chistiakov, A. N. Orekhov, and Y. V. Bobryshev, “Cardiac-specific miRNA in cardiogenesis, heart function, and cardiac pathology (with focus on myocardial infarction),” Journal of Molecular and Cellular Cardiology, vol. 94, pp. 107–121, 2016. View at: Publisher Site | Google Scholar
  19. J. Wang, Y. Zhou, X. Fei, X. Chen, and Y. Chen, “Biostatistics mining associated method identifies AKR1B10 enhancing hepatocellular carcinoma cell growth and degenerated by miR-383-5p,” Scientific Reports, vol. 8, no. 1, 2018. View at: Publisher Site | Google Scholar
  20. L. Qi, C. Gao, F. Feng et al., “MicroRNAs associated with lung squamous cell carcinoma: new prognostic biomarkers and therapeutic targets,” Journal of Cellular Biochemistry, vol. 120, no. 11, pp. 18956–18966, 2019. View at: Publisher Site | Google Scholar
  21. J. Zhang, X. Kong, Q. Shi, and B. Zhao, “MicroRNA-383-5p acts as a potential prognostic biomarker and an inhibitor of tumor cell proliferation, migration, and invasion in breast cancer,” Cancer Biomarkers, vol. 27, no. 4, pp. 423–432, 2020. View at: Publisher Site | Google Scholar
  22. E. A. Queiroz, Z. B. Fortes, C. M. Da, A. M. Barbosa, N. Khaper, and R. F. Dekker, “Antiproliferative and pro-apoptotic effects of three fungal exocellular β-glucans in MCF-7 breast cancer cells is mediated by oxidative stress, AMP- activated protein kinase (AMPK) and the Forkhead transcription factor, FOXO3a,” The International Journal of Biochemistry & Cell Biology, vol. 67, pp. 14–24, 2015. View at: Publisher Site | Google Scholar
  23. C. H. Lin, Y. C. Cheng, C. J. Nicol, K. H. Lin, C. H. Yen, and M. C. Chiang, “Activation of AMPK is neuroprotective in the oxidative stress by advanced glycosylation end products in human neural stem cells,” Experimental Cell Research, vol. 359, no. 2, pp. 367–373, 2017. View at: Publisher Site | Google Scholar
  24. R. Kosuru, V. Kandula, U. Rai, S. Prakash, Z. Xia, and S. Singh, “Pterostilbene decreases cardiac oxidative stress and inflammation via activation of AMPK/Nrf2/HO-1 pathway in fructose-fed diabetic rats,” Cardiovascular Drugs and Therapy, vol. 32, no. 2, pp. 147–163, 2018. View at: Publisher Site | Google Scholar
  25. F. Wu, Z. Li, M. Cai et al., “Aerobic exercise alleviates oxidative stress-induced apoptosis in kidneys of myocardial infarction mice by inhibiting ALCAT1 and activating FNDC5/Irisin signaling pathway,” Free Radical Biology & Medicine, vol. 158, pp. 171–180, 2020. View at: Publisher Site | Google Scholar
  26. X. Hou, S. Yang, and J. Yin, “Blocking the REDD1/TXNIP axis ameliorates LPS-induced vascular endothelial cell injury through repressing oxidative stress and apoptosis,” American Journal of Physiology. Cell Physiology, vol. 316, no. 1, pp. C104–C110, 2019. View at: Publisher Site | Google Scholar

Copyright © 2021 Linlin Gao et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


More related articles

 PDF Download Citation Citation
 Download other formatsMore
 Order printed copiesOrder
Views51
Downloads133
Citations

Related articles

Article of the Year Award: Outstanding research contributions of 2020, as selected by our Chief Editors. Read the winning articles.