Disease Markers / 2021 / Article / Tab 2

Research Article

The Role, Function, and Mechanism of Long Intergenic Noncoding RNA1184 (linc01184) in Colorectal Cancer

Table 2

The primer sequences included in this study.

GenesForward primer ()Reverse primer ()

Human-HER2GGTCTTGATCCAGCGGAACCAGCGGTTGGTGTCTATCAGT
linc01184CACCATCGTTTGCTGAACACTCCGCTTGCACCTTATCTCACTA
miR-331GCCCCUGGGCCUAUCCUAGAAUniversal qPCR primer
U6CTCGCTTCGGCAGCACAUniversal qPCR primer
β-ActinCTCCATCCTGGCCTCGCTGTGCTGTCACCTTCACCGTTCC